ID: 1077334880

View in Genome Browser
Species Human (GRCh38)
Location 11:1998774-1998796
Sequence CCAGCCCTTCCACATCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077334880_1077334885 9 Left 1077334880 11:1998774-1998796 CCTCTGGGATGTGGAAGGGCTGG No data
Right 1077334885 11:1998806-1998828 CGGCAAACCCTCTGTTCCCATGG No data
1077334880_1077334889 23 Left 1077334880 11:1998774-1998796 CCTCTGGGATGTGGAAGGGCTGG No data
Right 1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG No data
1077334880_1077334888 18 Left 1077334880 11:1998774-1998796 CCTCTGGGATGTGGAAGGGCTGG No data
Right 1077334888 11:1998815-1998837 CTCTGTTCCCATGGCCCCACCGG No data
1077334880_1077334890 24 Left 1077334880 11:1998774-1998796 CCTCTGGGATGTGGAAGGGCTGG No data
Right 1077334890 11:1998821-1998843 TCCCATGGCCCCACCGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077334880 Original CRISPR CCAGCCCTTCCACATCCCAG AGG (reversed) Intergenic
No off target data available for this crispr