ID: 1077334884

View in Genome Browser
Species Human (GRCh38)
Location 11:1998802-1998824
Sequence GGGAACAGAGGGTTTGCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077334884_1077334890 -4 Left 1077334884 11:1998802-1998824 CCTTCGGCAAACCCTCTGTTCCC No data
Right 1077334890 11:1998821-1998843 TCCCATGGCCCCACCGGAAAGGG No data
1077334884_1077334897 29 Left 1077334884 11:1998802-1998824 CCTTCGGCAAACCCTCTGTTCCC No data
Right 1077334897 11:1998854-1998876 GCCTGCTGAGCACTGACCGCCGG No data
1077334884_1077334889 -5 Left 1077334884 11:1998802-1998824 CCTTCGGCAAACCCTCTGTTCCC No data
Right 1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG No data
1077334884_1077334888 -10 Left 1077334884 11:1998802-1998824 CCTTCGGCAAACCCTCTGTTCCC No data
Right 1077334888 11:1998815-1998837 CTCTGTTCCCATGGCCCCACCGG No data
1077334884_1077334899 30 Left 1077334884 11:1998802-1998824 CCTTCGGCAAACCCTCTGTTCCC No data
Right 1077334899 11:1998855-1998877 CCTGCTGAGCACTGACCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077334884 Original CRISPR GGGAACAGAGGGTTTGCCGA AGG (reversed) Intergenic
No off target data available for this crispr