ID: 1077334889

View in Genome Browser
Species Human (GRCh38)
Location 11:1998820-1998842
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077334879_1077334889 24 Left 1077334879 11:1998773-1998795 CCCTCTGGGATGTGGAAGGGCTG No data
Right 1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG No data
1077334880_1077334889 23 Left 1077334880 11:1998774-1998796 CCTCTGGGATGTGGAAGGGCTGG No data
Right 1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG No data
1077334884_1077334889 -5 Left 1077334884 11:1998802-1998824 CCTTCGGCAAACCCTCTGTTCCC No data
Right 1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG No data
1077334883_1077334889 0 Left 1077334883 11:1998797-1998819 CCGCGCCTTCGGCAAACCCTCTG No data
Right 1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077334889 Original CRISPR TTCCCATGGCCCCACCGGAA AGG Intergenic
No off target data available for this crispr