ID: 1077336563

View in Genome Browser
Species Human (GRCh38)
Location 11:2007584-2007606
Sequence CCAGGACCTGTGAGTGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077336563_1077336569 -3 Left 1077336563 11:2007584-2007606 CCGGGGACACTCACAGGTCCTGG No data
Right 1077336569 11:2007604-2007626 TGGGTGGACATGAATTTCCAGGG No data
1077336563_1077336571 24 Left 1077336563 11:2007584-2007606 CCGGGGACACTCACAGGTCCTGG No data
Right 1077336571 11:2007631-2007653 TTATTCAGTGCAGCATAAAGTGG No data
1077336563_1077336568 -4 Left 1077336563 11:2007584-2007606 CCGGGGACACTCACAGGTCCTGG No data
Right 1077336568 11:2007603-2007625 CTGGGTGGACATGAATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077336563 Original CRISPR CCAGGACCTGTGAGTGTCCC CGG (reversed) Intergenic