ID: 1077336567

View in Genome Browser
Species Human (GRCh38)
Location 11:2007602-2007624
Sequence CTGGAAATTCATGTCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077336567_1077336572 23 Left 1077336567 11:2007602-2007624 CCTGGGTGGACATGAATTTCCAG No data
Right 1077336572 11:2007648-2007670 AAGTGGTAAGAGACAGATGTAGG No data
1077336567_1077336573 24 Left 1077336567 11:2007602-2007624 CCTGGGTGGACATGAATTTCCAG No data
Right 1077336573 11:2007649-2007671 AGTGGTAAGAGACAGATGTAGGG No data
1077336567_1077336574 30 Left 1077336567 11:2007602-2007624 CCTGGGTGGACATGAATTTCCAG No data
Right 1077336574 11:2007655-2007677 AAGAGACAGATGTAGGGCACTGG No data
1077336567_1077336571 6 Left 1077336567 11:2007602-2007624 CCTGGGTGGACATGAATTTCCAG No data
Right 1077336571 11:2007631-2007653 TTATTCAGTGCAGCATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077336567 Original CRISPR CTGGAAATTCATGTCCACCC AGG (reversed) Intergenic