ID: 1077336569 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:2007604-2007626 |
Sequence | TGGGTGGACATGAATTTCCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1077336558_1077336569 | 16 | Left | 1077336558 | 11:2007565-2007587 | CCTGGGTGGACATGAATTTCCGG | No data | ||
Right | 1077336569 | 11:2007604-2007626 | TGGGTGGACATGAATTTCCAGGG | No data | ||||
1077336563_1077336569 | -3 | Left | 1077336563 | 11:2007584-2007606 | CCGGGGACACTCACAGGTCCTGG | No data | ||
Right | 1077336569 | 11:2007604-2007626 | TGGGTGGACATGAATTTCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1077336569 | Original CRISPR | TGGGTGGACATGAATTTCCA GGG | Intergenic | ||