ID: 1077336571 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:2007631-2007653 |
| Sequence | TTATTCAGTGCAGCATAAAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1077336567_1077336571 | 6 | Left | 1077336567 | 11:2007602-2007624 | CCTGGGTGGACATGAATTTCCAG | No data | ||
| Right | 1077336571 | 11:2007631-2007653 | TTATTCAGTGCAGCATAAAGTGG | No data | ||||
| 1077336563_1077336571 | 24 | Left | 1077336563 | 11:2007584-2007606 | CCGGGGACACTCACAGGTCCTGG | No data | ||
| Right | 1077336571 | 11:2007631-2007653 | TTATTCAGTGCAGCATAAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1077336571 | Original CRISPR | TTATTCAGTGCAGCATAAAG TGG | Intergenic | ||
| No off target data available for this crispr | |||||