ID: 1077336571

View in Genome Browser
Species Human (GRCh38)
Location 11:2007631-2007653
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077336563_1077336571 24 Left 1077336563 11:2007584-2007606 CCGGGGACACTCACAGGTCCTGG No data
Right 1077336571 11:2007631-2007653 TTATTCAGTGCAGCATAAAGTGG No data
1077336567_1077336571 6 Left 1077336567 11:2007602-2007624 CCTGGGTGGACATGAATTTCCAG No data
Right 1077336571 11:2007631-2007653 TTATTCAGTGCAGCATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077336571 Original CRISPR TTATTCAGTGCAGCATAAAG TGG Intergenic