ID: 1077336572

View in Genome Browser
Species Human (GRCh38)
Location 11:2007648-2007670
Sequence AAGTGGTAAGAGACAGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077336570_1077336572 4 Left 1077336570 11:2007621-2007643 CCAGGGAACATTATTCAGTGCAG No data
Right 1077336572 11:2007648-2007670 AAGTGGTAAGAGACAGATGTAGG No data
1077336567_1077336572 23 Left 1077336567 11:2007602-2007624 CCTGGGTGGACATGAATTTCCAG No data
Right 1077336572 11:2007648-2007670 AAGTGGTAAGAGACAGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077336572 Original CRISPR AAGTGGTAAGAGACAGATGT AGG Intergenic