ID: 1077340175

View in Genome Browser
Species Human (GRCh38)
Location 11:2022924-2022946
Sequence ACCACTCGACTGCCGACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077340175_1077340179 -3 Left 1077340175 11:2022924-2022946 CCTGCGGTCGGCAGTCGAGTGGT No data
Right 1077340179 11:2022944-2022966 GGTCAGTGGGAGGCTGCTGTTGG No data
1077340175_1077340180 -2 Left 1077340175 11:2022924-2022946 CCTGCGGTCGGCAGTCGAGTGGT No data
Right 1077340180 11:2022945-2022967 GTCAGTGGGAGGCTGCTGTTGGG No data
1077340175_1077340182 8 Left 1077340175 11:2022924-2022946 CCTGCGGTCGGCAGTCGAGTGGT No data
Right 1077340182 11:2022955-2022977 GGCTGCTGTTGGGCCTCTGGTGG No data
1077340175_1077340181 5 Left 1077340175 11:2022924-2022946 CCTGCGGTCGGCAGTCGAGTGGT No data
Right 1077340181 11:2022952-2022974 GGAGGCTGCTGTTGGGCCTCTGG No data
1077340175_1077340183 16 Left 1077340175 11:2022924-2022946 CCTGCGGTCGGCAGTCGAGTGGT No data
Right 1077340183 11:2022963-2022985 TTGGGCCTCTGGTGGTCTCGAGG No data
1077340175_1077340185 24 Left 1077340175 11:2022924-2022946 CCTGCGGTCGGCAGTCGAGTGGT No data
Right 1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077340175 Original CRISPR ACCACTCGACTGCCGACCGC AGG (reversed) Intergenic
No off target data available for this crispr