ID: 1077340185

View in Genome Browser
Species Human (GRCh38)
Location 11:2022971-2022993
Sequence CTGGTGGTCTCGAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077340175_1077340185 24 Left 1077340175 11:2022924-2022946 CCTGCGGTCGGCAGTCGAGTGGT No data
Right 1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077340185 Original CRISPR CTGGTGGTCTCGAGGACAAA TGG Intergenic
No off target data available for this crispr