ID: 1077340747

View in Genome Browser
Species Human (GRCh38)
Location 11:2025307-2025329
Sequence CCGAGCACACCTGTGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077340747_1077340757 13 Left 1077340747 11:2025307-2025329 CCCTGGGGCACAGGTGTGCTCGG No data
Right 1077340757 11:2025343-2025365 CTGACTGCTCCCTTTGCGCAGGG No data
1077340747_1077340756 12 Left 1077340747 11:2025307-2025329 CCCTGGGGCACAGGTGTGCTCGG No data
Right 1077340756 11:2025342-2025364 CCTGACTGCTCCCTTTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077340747 Original CRISPR CCGAGCACACCTGTGCCCCA GGG (reversed) Intergenic