ID: 1077342124

View in Genome Browser
Species Human (GRCh38)
Location 11:2030864-2030886
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077342114_1077342124 19 Left 1077342114 11:2030822-2030844 CCTGAAAAGCTGTCAATAAAAGC No data
Right 1077342124 11:2030864-2030886 ATGCCAGGGGGGTCTCCAGGTGG No data
1077342113_1077342124 24 Left 1077342113 11:2030817-2030839 CCACTCCTGAAAAGCTGTCAATA No data
Right 1077342124 11:2030864-2030886 ATGCCAGGGGGGTCTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077342124 Original CRISPR ATGCCAGGGGGGTCTCCAGG TGG Intergenic