ID: 1077347503

View in Genome Browser
Species Human (GRCh38)
Location 11:2070666-2070688
Sequence TAGTGGGACAGGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077347503_1077347513 3 Left 1077347503 11:2070666-2070688 CCCTCCACCATCCTGTCCCACTA No data
Right 1077347513 11:2070692-2070714 ACCTGGCCTTTCAGTTGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077347503 Original CRISPR TAGTGGGACAGGATGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr