ID: 1077350073

View in Genome Browser
Species Human (GRCh38)
Location 11:2089037-2089059
Sequence GCAGCCGGGCAGTCAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077350064_1077350073 28 Left 1077350064 11:2088986-2089008 CCAGCTCTGAAAATGGGGTGGGA No data
Right 1077350073 11:2089037-2089059 GCAGCCGGGCAGTCAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077350073 Original CRISPR GCAGCCGGGCAGTCAGAGCC AGG Intergenic
No off target data available for this crispr