ID: 1077350559

View in Genome Browser
Species Human (GRCh38)
Location 11:2091284-2091306
Sequence CAGCCCCACAGGCCTCCGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077350559_1077350569 1 Left 1077350559 11:2091284-2091306 CCGGTCGGAGGCCTGTGGGGCTG No data
Right 1077350569 11:2091308-2091330 GGGCTGGGGAGCTGGCCCCCAGG No data
1077350559_1077350570 15 Left 1077350559 11:2091284-2091306 CCGGTCGGAGGCCTGTGGGGCTG No data
Right 1077350570 11:2091322-2091344 GCCCCCAGGCTGTAATTACCAGG No data
1077350559_1077350568 -7 Left 1077350559 11:2091284-2091306 CCGGTCGGAGGCCTGTGGGGCTG No data
Right 1077350568 11:2091300-2091322 GGGGCTGGGGGCTGGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077350559 Original CRISPR CAGCCCCACAGGCCTCCGAC CGG (reversed) Intergenic