ID: 1077350568

View in Genome Browser
Species Human (GRCh38)
Location 11:2091300-2091322
Sequence GGGGCTGGGGGCTGGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077350558_1077350568 -6 Left 1077350558 11:2091283-2091305 CCCGGTCGGAGGCCTGTGGGGCT No data
Right 1077350568 11:2091300-2091322 GGGGCTGGGGGCTGGGGAGCTGG No data
1077350559_1077350568 -7 Left 1077350559 11:2091284-2091306 CCGGTCGGAGGCCTGTGGGGCTG No data
Right 1077350568 11:2091300-2091322 GGGGCTGGGGGCTGGGGAGCTGG No data
1077350551_1077350568 8 Left 1077350551 11:2091269-2091291 CCTGGCTGCACAGCCCCGGTCGG No data
Right 1077350568 11:2091300-2091322 GGGGCTGGGGGCTGGGGAGCTGG No data
1077350557_1077350568 -5 Left 1077350557 11:2091282-2091304 CCCCGGTCGGAGGCCTGTGGGGC No data
Right 1077350568 11:2091300-2091322 GGGGCTGGGGGCTGGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077350568 Original CRISPR GGGGCTGGGGGCTGGGGAGC TGG Intergenic
No off target data available for this crispr