ID: 1077350569

View in Genome Browser
Species Human (GRCh38)
Location 11:2091308-2091330
Sequence GGGCTGGGGAGCTGGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077350551_1077350569 16 Left 1077350551 11:2091269-2091291 CCTGGCTGCACAGCCCCGGTCGG No data
Right 1077350569 11:2091308-2091330 GGGCTGGGGAGCTGGCCCCCAGG No data
1077350567_1077350569 -10 Left 1077350567 11:2091295-2091317 CCTGTGGGGCTGGGGGCTGGGGA No data
Right 1077350569 11:2091308-2091330 GGGCTGGGGAGCTGGCCCCCAGG No data
1077350557_1077350569 3 Left 1077350557 11:2091282-2091304 CCCCGGTCGGAGGCCTGTGGGGC No data
Right 1077350569 11:2091308-2091330 GGGCTGGGGAGCTGGCCCCCAGG No data
1077350558_1077350569 2 Left 1077350558 11:2091283-2091305 CCCGGTCGGAGGCCTGTGGGGCT No data
Right 1077350569 11:2091308-2091330 GGGCTGGGGAGCTGGCCCCCAGG No data
1077350559_1077350569 1 Left 1077350559 11:2091284-2091306 CCGGTCGGAGGCCTGTGGGGCTG No data
Right 1077350569 11:2091308-2091330 GGGCTGGGGAGCTGGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077350569 Original CRISPR GGGCTGGGGAGCTGGCCCCC AGG Intergenic
No off target data available for this crispr