ID: 1077350570

View in Genome Browser
Species Human (GRCh38)
Location 11:2091322-2091344
Sequence GCCCCCAGGCTGTAATTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077350558_1077350570 16 Left 1077350558 11:2091283-2091305 CCCGGTCGGAGGCCTGTGGGGCT No data
Right 1077350570 11:2091322-2091344 GCCCCCAGGCTGTAATTACCAGG No data
1077350567_1077350570 4 Left 1077350567 11:2091295-2091317 CCTGTGGGGCTGGGGGCTGGGGA No data
Right 1077350570 11:2091322-2091344 GCCCCCAGGCTGTAATTACCAGG No data
1077350557_1077350570 17 Left 1077350557 11:2091282-2091304 CCCCGGTCGGAGGCCTGTGGGGC No data
Right 1077350570 11:2091322-2091344 GCCCCCAGGCTGTAATTACCAGG No data
1077350551_1077350570 30 Left 1077350551 11:2091269-2091291 CCTGGCTGCACAGCCCCGGTCGG No data
Right 1077350570 11:2091322-2091344 GCCCCCAGGCTGTAATTACCAGG No data
1077350559_1077350570 15 Left 1077350559 11:2091284-2091306 CCGGTCGGAGGCCTGTGGGGCTG No data
Right 1077350570 11:2091322-2091344 GCCCCCAGGCTGTAATTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077350570 Original CRISPR GCCCCCAGGCTGTAATTACC AGG Intergenic
No off target data available for this crispr