ID: 1077353093

View in Genome Browser
Species Human (GRCh38)
Location 11:2101848-2101870
Sequence GTCCCAGTGGACGTCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077353093_1077353102 22 Left 1077353093 11:2101848-2101870 CCCACACTGACGTCCACTGGGAC No data
Right 1077353102 11:2101893-2101915 TGTGTCTGTCACTGTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077353093 Original CRISPR GTCCCAGTGGACGTCAGTGT GGG (reversed) Intergenic
No off target data available for this crispr