ID: 1077353102

View in Genome Browser
Species Human (GRCh38)
Location 11:2101893-2101915
Sequence TGTGTCTGTCACTGTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077353095_1077353102 9 Left 1077353095 11:2101861-2101883 CCACTGGGACCCCAGCCTTAGTG No data
Right 1077353102 11:2101893-2101915 TGTGTCTGTCACTGTCATTGTGG No data
1077353092_1077353102 23 Left 1077353092 11:2101847-2101869 CCCCACACTGACGTCCACTGGGA No data
Right 1077353102 11:2101893-2101915 TGTGTCTGTCACTGTCATTGTGG No data
1077353099_1077353102 -6 Left 1077353099 11:2101876-2101898 CCTTAGTGCTCCCTGTGTGTGTC No data
Right 1077353102 11:2101893-2101915 TGTGTCTGTCACTGTCATTGTGG No data
1077353097_1077353102 -1 Left 1077353097 11:2101871-2101893 CCCAGCCTTAGTGCTCCCTGTGT No data
Right 1077353102 11:2101893-2101915 TGTGTCTGTCACTGTCATTGTGG No data
1077353093_1077353102 22 Left 1077353093 11:2101848-2101870 CCCACACTGACGTCCACTGGGAC No data
Right 1077353102 11:2101893-2101915 TGTGTCTGTCACTGTCATTGTGG No data
1077353096_1077353102 0 Left 1077353096 11:2101870-2101892 CCCCAGCCTTAGTGCTCCCTGTG No data
Right 1077353102 11:2101893-2101915 TGTGTCTGTCACTGTCATTGTGG No data
1077353098_1077353102 -2 Left 1077353098 11:2101872-2101894 CCAGCCTTAGTGCTCCCTGTGTG No data
Right 1077353102 11:2101893-2101915 TGTGTCTGTCACTGTCATTGTGG No data
1077353094_1077353102 21 Left 1077353094 11:2101849-2101871 CCACACTGACGTCCACTGGGACC No data
Right 1077353102 11:2101893-2101915 TGTGTCTGTCACTGTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077353102 Original CRISPR TGTGTCTGTCACTGTCATTG TGG Intergenic
No off target data available for this crispr