ID: 1077353837

View in Genome Browser
Species Human (GRCh38)
Location 11:2105593-2105615
Sequence GGGCAGAGACAGATGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077353837_1077353848 5 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353848 11:2105621-2105643 GAACACCAAGTTGGGGCTGTGGG No data
1077353837_1077353846 -2 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353846 11:2105614-2105636 CCTGAAGGAACACCAAGTTGGGG No data
1077353837_1077353842 -4 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353842 11:2105612-2105634 GCCCTGAAGGAACACCAAGTTGG No data
1077353837_1077353854 23 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353854 11:2105639-2105661 GTGGGGCTGGGACCAGGCCTCGG No data
1077353837_1077353855 30 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353855 11:2105646-2105668 TGGGACCAGGCCTCGGAGCCAGG No data
1077353837_1077353849 6 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353849 11:2105622-2105644 AACACCAAGTTGGGGCTGTGGGG No data
1077353837_1077353851 10 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353851 11:2105626-2105648 CCAAGTTGGGGCTGTGGGGCTGG No data
1077353837_1077353852 11 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353852 11:2105627-2105649 CAAGTTGGGGCTGTGGGGCTGGG No data
1077353837_1077353844 -3 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353844 11:2105613-2105635 CCCTGAAGGAACACCAAGTTGGG No data
1077353837_1077353847 4 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353847 11:2105620-2105642 GGAACACCAAGTTGGGGCTGTGG No data
1077353837_1077353853 17 Left 1077353837 11:2105593-2105615 CCCTGTCCCATCTGTCTCTGCCC No data
Right 1077353853 11:2105633-2105655 GGGGCTGTGGGGCTGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077353837 Original CRISPR GGGCAGAGACAGATGGGACA GGG (reversed) Intergenic
No off target data available for this crispr