ID: 1077354402

View in Genome Browser
Species Human (GRCh38)
Location 11:2108595-2108617
Sequence CCTATTGTGGGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077354402_1077354411 5 Left 1077354402 11:2108595-2108617 CCCTCCTCCTTCCCCACAATAGG No data
Right 1077354411 11:2108623-2108645 CTCAGGCCACCCTGAGCGCCAGG No data
1077354402_1077354418 21 Left 1077354402 11:2108595-2108617 CCCTCCTCCTTCCCCACAATAGG No data
Right 1077354418 11:2108639-2108661 CGCCAGGGGCAAGGTGTGCCTGG No data
1077354402_1077354415 12 Left 1077354402 11:2108595-2108617 CCCTCCTCCTTCCCCACAATAGG No data
Right 1077354415 11:2108630-2108652 CACCCTGAGCGCCAGGGGCAAGG No data
1077354402_1077354412 6 Left 1077354402 11:2108595-2108617 CCCTCCTCCTTCCCCACAATAGG No data
Right 1077354412 11:2108624-2108646 TCAGGCCACCCTGAGCGCCAGGG No data
1077354402_1077354413 7 Left 1077354402 11:2108595-2108617 CCCTCCTCCTTCCCCACAATAGG No data
Right 1077354413 11:2108625-2108647 CAGGCCACCCTGAGCGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077354402 Original CRISPR CCTATTGTGGGGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr