ID: 1077358241

View in Genome Browser
Species Human (GRCh38)
Location 11:2128413-2128435
Sequence CTGTGGGGATGGAGGGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077358241_1077358260 28 Left 1077358241 11:2128413-2128435 CCCCTGTCCCTCCATCCCCACAG No data
Right 1077358260 11:2128464-2128486 CAAGGCTGCTGGAAAGTTCCTGG No data
1077358241_1077358256 17 Left 1077358241 11:2128413-2128435 CCCCTGTCCCTCCATCCCCACAG No data
Right 1077358256 11:2128453-2128475 GATCCACTGCCCAAGGCTGCTGG No data
1077358241_1077358252 -8 Left 1077358241 11:2128413-2128435 CCCCTGTCCCTCCATCCCCACAG No data
Right 1077358252 11:2128428-2128450 CCCCACAGCAGGCGGGGCACAGG No data
1077358241_1077358255 10 Left 1077358241 11:2128413-2128435 CCCCTGTCCCTCCATCCCCACAG No data
Right 1077358255 11:2128446-2128468 ACAGGCAGATCCACTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077358241 Original CRISPR CTGTGGGGATGGAGGGACAG GGG (reversed) Intergenic
No off target data available for this crispr