ID: 1077360805

View in Genome Browser
Species Human (GRCh38)
Location 11:2139471-2139493
Sequence CCGCGGGCGCCCATTGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077360805_1077360828 27 Left 1077360805 11:2139471-2139493 CCCGCGCCAATGGGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1077360828 11:2139521-2139543 CCGCAACCCGAGCCAAGAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077360805_1077360826 26 Left 1077360805 11:2139471-2139493 CCCGCGCCAATGGGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1077360826 11:2139520-2139542 CCCGCAACCCGAGCCAAGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 96
1077360805_1077360829 28 Left 1077360805 11:2139471-2139493 CCCGCGCCAATGGGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1077360829 11:2139522-2139544 CGCAACCCGAGCCAAGAGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1077360805_1077360811 -3 Left 1077360805 11:2139471-2139493 CCCGCGCCAATGGGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1077360811 11:2139491-2139513 CGGAGCCCTCGCCCCGCCCCCGG 0: 1
1: 1
2: 6
3: 52
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077360805 Original CRISPR CCGCGGGCGCCCATTGGCGC GGG (reversed) Intronic