ID: 1077360805

View in Genome Browser
Species Human (GRCh38)
Location 11:2139471-2139493
Sequence CCGCGGGCGCCCATTGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077360805_1077360828 27 Left 1077360805 11:2139471-2139493 CCCGCGCCAATGGGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1077360828 11:2139521-2139543 CCGCAACCCGAGCCAAGAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077360805_1077360829 28 Left 1077360805 11:2139471-2139493 CCCGCGCCAATGGGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1077360829 11:2139522-2139544 CGCAACCCGAGCCAAGAGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1077360805_1077360826 26 Left 1077360805 11:2139471-2139493 CCCGCGCCAATGGGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1077360826 11:2139520-2139542 CCCGCAACCCGAGCCAAGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 96
1077360805_1077360811 -3 Left 1077360805 11:2139471-2139493 CCCGCGCCAATGGGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1077360811 11:2139491-2139513 CGGAGCCCTCGCCCCGCCCCCGG 0: 1
1: 1
2: 6
3: 52
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077360805 Original CRISPR CCGCGGGCGCCCATTGGCGC GGG (reversed) Intronic
900314468 1:2050188-2050210 GCGCGCGGTCCCATTGGCGCAGG + Intergenic
901251678 1:7784190-7784212 CCGCAGGCCTCCATTGGCCCTGG - Intergenic
904586672 1:31584605-31584627 CCTCAGGTGCCCATTGGCACTGG - Intronic
907430080 1:54406470-54406492 CCGCGTGCGCCGATTGGCCGAGG - Intronic
1063115111 10:3067463-3067485 CCGTCACCGCCCATTGGCGCTGG + Intronic
1067474378 10:46556461-46556483 CCGCGCGCTCCCGTTGGGGCGGG - Intergenic
1075112292 10:119596997-119597019 CCGCCGGCGCCCACCCGCGCTGG + Intronic
1076893766 10:133298609-133298631 CCTCTGGCGGCCACTGGCGCAGG - Intronic
1077360805 11:2139471-2139493 CCGCGGGCGCCCATTGGCGCGGG - Intronic
1081812815 11:45922891-45922913 CCGAGGGCGCCCCCGGGCGCTGG + Exonic
1084310205 11:68312473-68312495 CCGCGGGCGCCCCCCGGAGCCGG - Intergenic
1091273129 11:134331926-134331948 CCGCCGGCGCTCATTGGCTGGGG - Exonic
1096813760 12:54188728-54188750 CCGGGGGCGCCCGCTGGCTCCGG + Intronic
1103623846 12:122204373-122204395 CCGCGGGCGTCCCCAGGCGCTGG - Intronic
1108991105 13:56659189-56659211 ACGCGGGAGCCCACTGGGGCTGG + Intergenic
1112041474 13:95552599-95552621 TCGCGTGCGCCCCCTGGCGCCGG + Intronic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113655662 13:112066845-112066867 CCGCCGGCTCCCATTGGCCGCGG + Intergenic
1116817837 14:49599723-49599745 GCGCGGGCGCCGAGTGGCGGGGG + Intronic
1117937265 14:60920128-60920150 CTGGGGGCGGCCATTGGGGCTGG + Intronic
1119290551 14:73491674-73491696 CCTCGCGCTCCCATAGGCGCCGG - Exonic
1122558156 14:102592516-102592538 CCTCGCGCTCCCATTGGCTCTGG - Intergenic
1126852625 15:52806242-52806264 CTGCGGGCGGCCAGCGGCGCGGG - Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1132807681 16:1782580-1782602 CCCCCTGCGCCCATTGGCTCCGG + Exonic
1132807684 16:1782583-1782605 CCGCCGGAGCCAATGGGCGCAGG - Exonic
1132902926 16:2268175-2268197 TCGCTGGCGCCCATTGGGCCAGG - Intronic
1136913547 16:34162292-34162314 CCGCCGGCTCCCGTTGGGGCCGG + Intergenic
1141742844 16:85905538-85905560 ACGCGGGTGCCCACTGGAGCAGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1151370893 17:73645407-73645429 CCGCGGGCGCCCAGCGGCTCTGG + Intergenic
1152321575 17:79610936-79610958 CCTCGCGCGCCCCTTGCCGCTGG - Intergenic
1152729101 17:81961177-81961199 CCCCCGCCGCTCATTGGCGCGGG - Exonic
1152824877 17:82458536-82458558 CCGCGCGCTCCGATTGGCTCTGG + Intronic
1156350378 18:36297498-36297520 CCGCCGCCGGCCTTTGGCGCAGG + Intergenic
1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG + Intergenic
1163359348 19:16836084-16836106 CCTCGGGCAGCCTTTGGCGCAGG + Intronic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
1165331469 19:35143088-35143110 CTGCTGGGGCCCAGTGGCGCTGG - Intronic
1167134444 19:47608721-47608743 CCGCAGCCTCCCATTGGCTCCGG + Intronic
1168259575 19:55185925-55185947 CCGCAGGTGCCCATGGGTGCAGG + Exonic
928854609 2:35789277-35789299 CCAGGGGCGCCCATTTGAGCTGG + Intergenic
929966822 2:46542779-46542801 GCGCGGGCGCCGAGTGGCGGGGG + Exonic
932562696 2:72887279-72887301 CCGCGAGCGCCCAGGGGTGCTGG - Intergenic
934716985 2:96550137-96550159 CGGCGGGCGCCCCCTGGCGGCGG - Intronic
938301137 2:130213739-130213761 GCGCGGGCGCCCAGTGGCGGGGG - Intergenic
938455578 2:131460728-131460750 GCGCGGGCGCCGAGTGGCGGGGG + Intergenic
1169496733 20:6122886-6122908 CGGGGGGCGCCCAGTGGCGGCGG + Exonic
1171810516 20:29742299-29742321 CCGCCGGCTCCCGTTGGGGCCGG - Intergenic
1173582934 20:44160131-44160153 GCGCGGGCGCCCAAGGGCGGCGG - Exonic
1175715816 20:61253399-61253421 CCGGGGGCGCCCCTGGGCGGAGG + Intronic
1176022561 20:62969446-62969468 CAGCGTGCGCCCACTGGCACTGG - Exonic
1181068901 22:20320454-20320476 CCGCGGCCGAGCAGTGGCGCTGG + Intergenic
1182260976 22:29073050-29073072 CCGGGGGCGGCCATGGGAGCAGG - Intergenic
1182804475 22:33058432-33058454 CCGCGGCGCCCCATTGGCTCGGG + Intergenic
1185417848 22:50720020-50720042 CCGCGGGCGTCCATTGTGTCCGG + Intergenic
954113180 3:48447055-48447077 CCGCGGCCGGACATTGGCTCAGG - Exonic
969637012 4:8375125-8375147 CCACGGCCGTCCGTTGGCGCTGG - Exonic
970394721 4:15654910-15654932 CCGAGGGCGGCCAGTGACGCCGG + Intronic
980865958 4:138553430-138553452 CCGCGGGAGCCCACTGGTGGGGG - Intergenic
983656497 4:170090024-170090046 CCGCGGGCGGCCATAGGCCACGG - Intronic
986216552 5:5724826-5724848 CTGCGGGAGACCATTGGCACTGG - Intergenic
1007774882 6:44219465-44219487 CCTCGGGTGCCCAAAGGCGCCGG + Intergenic
1019475608 7:1242709-1242731 CCGCGGGCTCCGCGTGGCGCTGG + Intergenic
1024089107 7:45921062-45921084 CCGCGGGCCGCCGGTGGCGCGGG - Exonic
1033306884 7:140231460-140231482 CCGCGGGCTTCCATTGGCTCGGG - Intergenic
1034446069 7:151114969-151114991 CCGCGGGCGCCGGTGGGCGGCGG - Intronic
1034470380 7:151251656-151251678 CGGCGGGCGCCCTATTGCGCTGG - Intronic
1036482628 8:9151633-9151655 CCGGGCGCGCCCATTGGCTGCGG - Intergenic
1039897366 8:41725707-41725729 CCGCGGACGCCCGTGGGCTCAGG - Intronic
1053240044 9:36487744-36487766 CCGCGGCCGCCAATGGGCGCGGG + Intergenic
1057312544 9:93951315-93951337 CCGCGGGTGCCCAAAGGAGCGGG - Intergenic
1058687231 9:107489607-107489629 GCGCGCGCGGCCATGGGCGCGGG + Exonic
1059414731 9:114155800-114155822 GCTCGGGCGCCCCTGGGCGCGGG + Exonic
1062421301 9:136483887-136483909 CCGCGGGCACCGAGCGGCGCCGG + Exonic
1203360785 Un_KI270442v1:218044-218066 CCGCCGGCTCCCATTGGGGCCGG - Intergenic
1186463368 X:9765688-9765710 CGGCGGGCTCCGCTTGGCGCTGG - Exonic
1188004087 X:25005496-25005518 CCGCGGCCGCCCTTCCGCGCGGG + Intronic
1195060742 X:101191610-101191632 CCCCGGGCGCCCAGTGGTGGTGG - Intergenic
1199699625 X:150365545-150365567 CAGCGGGCGCCCCTCGCCGCCGG + Intronic