ID: 1077362567

View in Genome Browser
Species Human (GRCh38)
Location 11:2147215-2147237
Sequence AAGTGGGTAGAGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1020
Summary {0: 1, 1: 1, 2: 7, 3: 93, 4: 918}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077362567_1077362572 3 Left 1077362567 11:2147215-2147237 CCTTTTTCCCTCTCTACCCACTT 0: 1
1: 1
2: 7
3: 93
4: 918
Right 1077362572 11:2147241-2147263 GCCCCCCATCTTCTCCCCTTTGG 0: 1
1: 0
2: 2
3: 28
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077362567 Original CRISPR AAGTGGGTAGAGAGGGAAAA AGG (reversed) Intronic
900830163 1:4959988-4960010 AAGGAGGTGGAGAGGGAAGAGGG + Intergenic
901229639 1:7634565-7634587 AAGGAGGGAGAGAGGGAAAGAGG + Intronic
901433320 1:9231652-9231674 AGGTGGGGAGGGAGGGAAACAGG - Intergenic
901538900 1:9901956-9901978 GGCTGGGTAGAGAGGGCAAAGGG - Intronic
901794671 1:11673425-11673447 GAGTGGGTAGAGAGAGCAAGTGG - Intronic
902584321 1:17428811-17428833 AAGTGAGGTGAGAGGGAAGATGG + Intronic
903062671 1:20681160-20681182 AAGAGGTTAAAGAGGCAAAAAGG + Intronic
903389995 1:22956913-22956935 AAATGGGTAGCTAGGGAGAAGGG - Intronic
903868574 1:26415895-26415917 AAGTTGGTAGAGAGGTAGGAAGG + Intronic
903956868 1:27031864-27031886 AAGTGGGGAGAGACGGAAGGAGG - Intergenic
904480743 1:30791748-30791770 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
904535844 1:31198872-31198894 AGGTGGGGAGTGAGGGACAAGGG + Intronic
904553508 1:31341484-31341506 AAATGGGTAGGGAAGGGAAAGGG + Intronic
905229275 1:36504000-36504022 AAGAGGATAGAGAGAGAAAGAGG - Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906209112 1:44002491-44002513 AGGTGGGAAGTGAGGGAAACCGG - Exonic
906288234 1:44602429-44602451 AAGTGAGTAGAGAGAGTAAAGGG + Intronic
906532968 1:46533861-46533883 AAGTGAGGAGAGAGGGAGGATGG - Intergenic
906539592 1:46575033-46575055 AAATAGGAGGAGAGGGAAAAGGG + Intronic
906746924 1:48228577-48228599 AAGTGGGAAAAAAGGGAAAGTGG - Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907505439 1:54914798-54914820 AGCTGGGTATAGAGGGACAATGG + Intergenic
907701037 1:56788608-56788630 AAGTGGGGAGGGAGTGAAAAGGG - Intronic
908914449 1:69109654-69109676 GTGGGGGTAGAGAGGGAAAGAGG - Intergenic
909043035 1:70676201-70676223 AGGTGGAGAGAGAGAGAAAACGG + Intergenic
909357868 1:74730011-74730033 AAGTAGGTAGATATCGAAAATGG - Intronic
909362033 1:74772050-74772072 CGGTGGGTAAAGAAGGAAAAAGG + Intergenic
910012270 1:82480161-82480183 AAGTAAGAAGAGAGGGGAAATGG - Intergenic
910028828 1:82690507-82690529 CAGTGGGGAGAGAGAGAGAAAGG - Intergenic
910178061 1:84452482-84452504 AACTAGGTAGAGAGGAAAGAAGG + Intergenic
910591193 1:88929306-88929328 AGCTGGGTATAGAGGGACAACGG - Intergenic
910971825 1:92863697-92863719 AAGTTGGTATAAAGGGAAAAGGG + Intronic
911001755 1:93173055-93173077 ACTTGGGGAGAGAGGGAATAGGG + Intronic
911269600 1:95784685-95784707 AGGTGGGGAGAGAGGGTGAAAGG - Intergenic
911620670 1:100063987-100064009 AAGTGTGGGGAAAGGGAAAATGG - Intronic
911694605 1:100875526-100875548 AATTGGCTAGAGAGGGAAAAGGG + Intronic
912463770 1:109855216-109855238 CAGTGGGTATAGAGAGACAACGG + Intergenic
912596401 1:110881228-110881250 AGGTGAGTAGAGAGGGAGCAGGG - Intronic
912688994 1:111789555-111789577 AAGAGACTAGAGATGGAAAACGG + Intronic
912740995 1:112197271-112197293 GAGAGGGTAGAAAGAGAAAAGGG + Intergenic
913044460 1:115062110-115062132 AAGTGGGGCGAGGGGGTAAATGG - Intronic
913963612 1:143357141-143357163 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
914057972 1:144182730-144182752 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
914121174 1:144783635-144783657 AAGAGAGGAGAGAGGGAAGAGGG + Intergenic
914675283 1:149903472-149903494 ATGTGGGGAGTGAGGGACAAGGG + Exonic
914677955 1:149918098-149918120 AAGTGGGAAGACAGGGAGATGGG + Intergenic
914687741 1:149996255-149996277 AAGTGAGTGGAGAGGGAGAAGGG + Intronic
914980508 1:152410695-152410717 AAGTGGGAAGGGCGGGGAAAGGG - Exonic
915239390 1:154509277-154509299 AACTGGTTAGCAAGGGAAAATGG - Intronic
915614374 1:157025424-157025446 AATCTGGTAGAGAGGGAAAAAGG + Intronic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
916164775 1:161956330-161956352 AAATGGGGAGAGAGGGACTATGG + Intronic
916291015 1:163166178-163166200 AAGAGGGTCCACAGGGAAAAAGG + Intronic
916697693 1:167256253-167256275 AAGAGAAGAGAGAGGGAAAAGGG + Intronic
917014432 1:170513300-170513322 AAGTAGGTAGGAAGAGAAAAAGG + Intergenic
917512938 1:175683094-175683116 AAGTGGACAGGGAGAGAAAAGGG - Intronic
917574303 1:176304802-176304824 AACTCAGAAGAGAGGGAAAATGG + Intergenic
918029669 1:180793109-180793131 AAGGAGGGAGAGAGGGAAGAAGG + Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918920930 1:190708764-190708786 AAGGAGGGAGGGAGGGAAAAAGG - Intergenic
919041380 1:192392609-192392631 AAGTGGGGAGGGAGGGACAGAGG + Intergenic
919105314 1:193142652-193142674 AAGGAGGAAGAGAGGGAAACGGG - Intronic
919373732 1:196764341-196764363 AAGTGTGGGGAGAGGGGAAAGGG + Intergenic
919380173 1:196849018-196849040 AAGTGTGGGGAGAGGGGAAAGGG + Intronic
919543428 1:198880278-198880300 AAGTGAGTAGAGGGAGAAGAAGG + Intergenic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
919971155 1:202580100-202580122 AATTGGGGAGAGAGCCAAAATGG - Intronic
920234410 1:204493470-204493492 AAGCGGGTGGAGAGGAGAAAAGG + Intronic
921092585 1:211857698-211857720 AGCTGGGTATAGAGGGACAACGG + Intergenic
921317307 1:213904960-213904982 AGGTAGGAAGAGAGGGAAAAAGG + Intergenic
921361849 1:214337318-214337340 AAATGGGAAGAAAGAGAAAAAGG + Intergenic
922017263 1:221662947-221662969 AAGAGAGAAGAGAGAGAAAATGG - Intergenic
922296798 1:224257045-224257067 AGCTGGGTTGAGAGGGCAAAAGG - Intronic
923012170 1:230096491-230096513 AAGAAGGGAGAGAGGGGAAAGGG - Intronic
923689345 1:236177327-236177349 GAGGGGGTAGAGAGAGAAAGAGG - Intronic
923991902 1:239447394-239447416 ATGTGGGGAGAGAGAGAGAATGG + Intronic
924162096 1:241243646-241243668 AATAGGGTACAGAGGGATAAAGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924854536 1:247863134-247863156 AAGGAGGTAGAGATGGAAAATGG + Intronic
1062863617 10:830307-830329 AATTGGATGGAGGGGGAAAAGGG - Intronic
1063290268 10:4738628-4738650 AAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1063497120 10:6520311-6520333 AAGTGGGTCGTGAGGCACAAGGG - Intronic
1063545232 10:6974668-6974690 AAAAGGGTAGAGAGAGAGAAAGG - Intergenic
1063652583 10:7953182-7953204 AAGTGAGAAGACTGGGAAAATGG - Intronic
1064167048 10:12995585-12995607 AAGTGGGTAGGGAGTAAAAACGG + Intronic
1064231201 10:13529920-13529942 AAAAGAGTAGAGAGGAAAAAGGG + Intergenic
1064502310 10:15987214-15987236 AAGTCAGGGGAGAGGGAAAACGG + Intergenic
1064684635 10:17847410-17847432 AAGTGGTTAGCGAGTGAAGAAGG - Intronic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065784858 10:29203676-29203698 AAGGAGGGAGGGAGGGAAAAAGG + Intergenic
1066034110 10:31463589-31463611 AGGATGGTAGAGATGGAAAATGG - Intronic
1066155920 10:32677800-32677822 AAGAAGAAAGAGAGGGAAAATGG - Intronic
1066784104 10:38983267-38983289 GAGGGAGTAGAGAGGGGAAAGGG + Intergenic
1067052812 10:43032894-43032916 GAATGAGGAGAGAGGGAAAAGGG + Intergenic
1067083637 10:43227085-43227107 CAGTGGGTTAAGGGGGAAAAGGG + Intronic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067940324 10:50649843-50649865 AAGAAGGGAAAGAGGGAAAAGGG + Intergenic
1068373926 10:56154847-56154869 AAGAGGGAAGAGAGGAAAAGAGG - Intergenic
1068741459 10:60477135-60477157 AAGTGGGGAGAGAGTGAAAGGGG + Intronic
1069157284 10:65046796-65046818 AAGTGTGTAGAGTGGGAGGAGGG + Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069389777 10:67921397-67921419 AAGTGGATGAACAGGGAAAATGG + Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069853050 10:71422984-71423006 AAGGGGAGAGAGAGGGAAAGAGG - Intronic
1070326429 10:75392495-75392517 ATTTTGGTAGAAAGGGAAAAAGG + Intergenic
1070437715 10:76410152-76410174 GAGGGGATAGAGAGAGAAAAAGG + Intronic
1070487558 10:76945038-76945060 AAGTGAGAGGAGAGGGAAAGAGG + Intronic
1070574432 10:77666865-77666887 TGGTGGGTGGAGAGGGAAATTGG - Intergenic
1070817629 10:79335389-79335411 GAGTGGGCAGAGAGGAAAATGGG + Intergenic
1071218050 10:83430567-83430589 AAGTGGGTATTAAGGGAAAGAGG + Intergenic
1071444810 10:85735964-85735986 AAGAAGGGAGAGAGGGAGAAAGG + Intronic
1072086474 10:92084537-92084559 ATGAGGGTAGAGAGGGAGATGGG - Intronic
1072141715 10:92594701-92594723 AAAGGGATGGAGAGGGAAAAGGG - Intronic
1072475061 10:95751929-95751951 AAGTAGGGAGAGAAGGCAAAGGG + Intronic
1072790243 10:98312515-98312537 AAGTGGGAAGAGGGAGAAACAGG - Intergenic
1072866238 10:99065310-99065332 AACTGGGTGCAGAAGGAAAATGG - Intronic
1072940810 10:99761981-99762003 GAGTGGGGAGAGAAGGAAAGAGG + Intergenic
1073170613 10:101504683-101504705 AAGTGAGGAGAGAAAGAAAAGGG - Intronic
1073625355 10:105091106-105091128 AAGGAGGGAGGGAGGGAAAAAGG - Intronic
1073637782 10:105217143-105217165 AACTGGGAACAAAGGGAAAACGG - Intronic
1073735072 10:106336260-106336282 AAGGGGATGGAGTGGGAAAAGGG - Intergenic
1073860577 10:107733415-107733437 AAGTGGGATGAGAGAGAATAGGG + Intergenic
1073911217 10:108347043-108347065 AAGTGAGGGGAGAGGGAAAGAGG + Intergenic
1074006288 10:109427781-109427803 ATTTGGGTGGAGAGGGAACAGGG + Intergenic
1074204658 10:111272271-111272293 AAGTGGGGAGAGAGGGAGAGGGG + Intergenic
1074443832 10:113501682-113501704 AAGTTGTCAGAGAAGGAAAAGGG + Intergenic
1074731820 10:116386477-116386499 AAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075507446 10:123036913-123036935 AAGTCGGTAGAGAAGGCAACCGG - Intronic
1075963000 10:126585414-126585436 AGGGAGGGAGAGAGGGAAAATGG + Intronic
1075995681 10:126874294-126874316 AAGTGGGGAGGGAGGCAAAGAGG - Intergenic
1076494930 10:130890827-130890849 GAGAGGGGAGAGAGGGAAAGAGG + Intergenic
1076682114 10:132178345-132178367 AAGGGGGTAGAGGAGGAAGAGGG + Intronic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1078376641 11:10800181-10800203 AAGTAGGAAGAGAGGAAAATGGG + Exonic
1078589932 11:12631504-12631526 AAGAGGGAAGAGAGAGAAAGAGG + Intergenic
1078594935 11:12677401-12677423 AAGTGGGGGGAGAGAGGAAATGG - Intronic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1078790803 11:14540111-14540133 GGGTGGGTAGAGAGGGTCAAGGG - Intronic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079442486 11:20529156-20529178 ACGTAGTTAGAGAGGAAAAAGGG + Intergenic
1079587076 11:22139433-22139455 AAGTAGGAAGAGAGGGAGAGAGG - Intergenic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079929688 11:26542430-26542452 GAGGGCATAGAGAGGGAAAATGG + Intronic
1080237083 11:30082940-30082962 AAGGAGGGAGGGAGGGAAAAAGG + Intergenic
1080368964 11:31611856-31611878 AAGTGGGCAGAGAGGGCAGTGGG + Intronic
1080889933 11:36400781-36400803 AAGTGGGAAGACAGTGACAATGG - Intronic
1080939115 11:36894832-36894854 TAGTGTGTAAAGGGGGAAAAAGG + Intergenic
1081881328 11:46455326-46455348 GACTGGGGAGAGAGGGAAAGAGG - Intronic
1082192569 11:49265242-49265264 AAGGAGGAAGAGAGGGAGAAGGG + Intergenic
1082258095 11:50054425-50054447 AAGAGGGTTAAGAGGGACAAAGG - Intergenic
1083695833 11:64441767-64441789 TAGTAGATAGAGAGAGAAAATGG + Intergenic
1083902680 11:65651217-65651239 AGGTGGGTAGAGAGAGGACAAGG - Intergenic
1083960557 11:66012710-66012732 AGGTGGGGAGAGAGGGAGAGGGG - Intronic
1083996290 11:66274718-66274740 AAGAGGGGAGAGGGGGAAGAGGG - Intronic
1084440198 11:69168289-69168311 GAGAGGGTAGAGAGGGAGAAGGG + Intergenic
1084584351 11:70048669-70048691 GAGTGGGGAGAGGGGGAGAAGGG - Intergenic
1084897394 11:72283576-72283598 AATTGGCTAGAGAGGGATAGGGG + Intergenic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1085060978 11:73446811-73446833 GATTGGAGAGAGAGGGAAAAAGG - Intronic
1085211220 11:74780968-74780990 AAGTAGGTGGAGAGGGCAAGAGG - Intronic
1085212495 11:74793846-74793868 CAGTGGGAAGAAAGGTAAAAAGG - Intronic
1085381077 11:76119305-76119327 AAGAGAGTACAGAGAGAAAAAGG - Intronic
1085389242 11:76174060-76174082 TAGCTGGTAGAGAGGGAAGAGGG + Intergenic
1085593428 11:77786933-77786955 AACTGGGTAAAGAGGCAAACAGG + Intronic
1085787826 11:79470629-79470651 AAGGGGGTGCAGAGGGATAAAGG - Intergenic
1085857563 11:80192759-80192781 AGGTGAGTACAGAGAGAAAAAGG + Intergenic
1085939234 11:81188337-81188359 AAGTGGGAAAAGAGGAAAAAAGG + Intergenic
1086077441 11:82869479-82869501 AAGAAGGAAGAGAGGGAGAAAGG + Intronic
1086170647 11:83832604-83832626 GAGTGGGGAGGGAAGGAAAAGGG + Intronic
1086202301 11:84218254-84218276 AAGGAGGGAGGGAGGGAAAAAGG + Intronic
1086441839 11:86836142-86836164 AGCTGGGTATAGAGGGACAAGGG + Intronic
1086575864 11:88338289-88338311 AAGTAGGAAGAGTTGGAAAACGG - Intergenic
1086774497 11:90813522-90813544 AATTTGGTAGAAAGGGTAAATGG - Intergenic
1087015890 11:93554448-93554470 GGGTGGGTTGAGGGGGAAAAAGG - Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087663683 11:101017311-101017333 TGGGGGGTAGAGAGAGAAAAAGG - Intergenic
1088201985 11:107347002-107347024 AAGTTGGTAGGTGGGGAAAAAGG - Intronic
1088480369 11:110291336-110291358 AAGGAGGGAGACAGGGAAAAAGG + Intronic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088674652 11:112180675-112180697 AAGTGGGTGGAGGGGGGGAAGGG + Intronic
1088979414 11:114848464-114848486 AAGAAGGAAGAGAGAGAAAAAGG + Intergenic
1088984708 11:114895432-114895454 AGGTGGGTGAAGAGGGAAAGAGG - Intergenic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG + Intergenic
1089679335 11:120110642-120110664 ATGATGGTAGAGAGGGAAGAGGG - Intergenic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090303728 11:125672097-125672119 GAGTGTGTAGGGATGGAAAAGGG + Exonic
1090339305 11:126002518-126002540 TAGTGGGTAGAGAAGGGAACTGG - Intronic
1090733549 11:129591834-129591856 AAGAGGGTGGAAAGGGAACAAGG - Intergenic
1091510695 12:1121441-1121463 ATGTTGGTAGAGAGGAGAAAAGG + Intronic
1091989260 12:4941431-4941453 AAGTGGATAGAAAGTGAGAATGG + Intergenic
1092059484 12:5536802-5536824 ATGTGAGAACAGAGGGAAAATGG + Intronic
1092230033 12:6770992-6771014 AAAAGGGTAGAGAGGGAGGAGGG + Intergenic
1092294219 12:7185355-7185377 AGCTGGGTATAGAGGGACAACGG - Intergenic
1092469295 12:8764012-8764034 AGCTGGGTATAGAGGGACAACGG + Intronic
1092508664 12:9129560-9129582 AAATGGGTAAAATGGGAAAAAGG - Intergenic
1092656568 12:10691169-10691191 AAGTGGTGAGGCAGGGAAAAAGG + Intergenic
1093118981 12:15244946-15244968 AAGGGGGTAGAGGGGGAGAGAGG + Intronic
1093209583 12:16292317-16292339 AAGAGGGGAGAAAGGGCAAAAGG + Intergenic
1093311267 12:17589024-17589046 AAGTGGGTAGAGGATGGAAAGGG - Intergenic
1093759273 12:22888791-22888813 AAAGGGCAAGAGAGGGAAAAGGG - Intergenic
1093971108 12:25376854-25376876 AAGAGGGAAGGGAGGGAAAGGGG + Intergenic
1094019574 12:25899990-25900012 AAGGGGGAAGAAAGGGTAAAGGG - Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096004793 12:48160706-48160728 AAATGTGTTGTGAGGGAAAATGG + Intronic
1096145911 12:49278554-49278576 AAGTGTGCAGAGAGGGTGAAGGG - Intergenic
1096212957 12:49780358-49780380 AATTGGATAAAAAGGGAAAAAGG - Intergenic
1096307814 12:50493754-50493776 AAATGGGGAGACAGGGAATATGG - Intergenic
1096586096 12:52620952-52620974 AAGTGAGTAGAGAGGACCAAAGG - Intergenic
1096693660 12:53335709-53335731 GGGGGGGTAGAGAGAGAAAAGGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096710931 12:53455004-53455026 AAGTGAGTGTAGTGGGAAAATGG + Intronic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1097378296 12:58863679-58863701 AAGTGGGTATAATGTGAAAATGG - Intergenic
1097956211 12:65487955-65487977 AAGAGGGTAGGGAGAGAGAAAGG - Intronic
1097968516 12:65607410-65607432 AAATCTGTAGAGAGTGAAAAAGG - Intergenic
1098289187 12:68940204-68940226 ATGTGGGTAGGGCAGGAAAAGGG - Intronic
1098334305 12:69386642-69386664 ATGTGGGGAGAGAGGGTATAGGG + Intronic
1099294246 12:80810161-80810183 AGGAGGGTAGACAGAGAAAAGGG - Intronic
1099981961 12:89614629-89614651 AAGTGTGTAGCTAGGGAAGAAGG - Intronic
1100045801 12:90379053-90379075 AAGAGGGTAGAGAAGAAAAGAGG + Intergenic
1100107196 12:91190338-91190360 AAGTGGGAGGAGAGTGAAATGGG + Intergenic
1100180242 12:92077564-92077586 AAGTGGGTAGAGACTGAGAGGGG + Intronic
1100431975 12:94539047-94539069 AAGCAGGTAGAGAGGGAGACAGG - Intergenic
1100726007 12:97409385-97409407 AAACGTGTACAGAGGGAAAATGG - Intergenic
1101054960 12:100903015-100903037 AAGTGGCAGAAGAGGGAAAAGGG - Intronic
1101255528 12:102973488-102973510 AAGGGGGGAGGGAGGGAGAAAGG - Intergenic
1101461610 12:104902353-104902375 AACTGGATAGAGAGTGAAGAGGG + Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101719263 12:107337045-107337067 AACTGGGTACAAAGGGATAATGG - Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102190041 12:110980870-110980892 AGGTGGGAAGAGAGAGAAAGTGG + Intergenic
1102431501 12:112887761-112887783 AAGGGGGTAGAGAGAGAAACAGG - Intronic
1102513678 12:113432662-113432684 AAGTGGGGAGAGAGAGAGAGTGG - Intronic
1102882135 12:116493751-116493773 AAATGGGGAAACAGGGAAAAAGG - Intergenic
1103256043 12:119542353-119542375 AAGGAGGTAGAGGAGGAAAAGGG + Intergenic
1104158199 12:126153452-126153474 ATCTGGGAAGAGAAGGAAAATGG + Intergenic
1104632071 12:130411694-130411716 AAGTGAGTAGAGGGGATAAAGGG + Intronic
1105519321 13:21117382-21117404 CAGAGGGTAGAGAGGCAAATGGG + Intergenic
1106556253 13:30810856-30810878 AATTGGGTAGGGAAGAAAAATGG - Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1106770193 13:32954268-32954290 AAGAGGGGAGAGATGGAAAGTGG + Intergenic
1107477298 13:40750961-40750983 AAGTGGGTAAAGAGGTAAGCTGG - Intronic
1107590079 13:41894382-41894404 AAGTAGGGATAGATGGAAAAAGG + Intronic
1107804154 13:44138605-44138627 AGGAGGGTAGAAATGGAAAATGG + Intergenic
1108044346 13:46369079-46369101 AAGAGGGTAGAAAGAGAATAGGG + Intronic
1108346920 13:49555476-49555498 AAGAAGGTAGAAAGGGAAATGGG + Intronic
1108807378 13:54175884-54175906 TAGTGAGTGGAGAGAGAAAAGGG + Intergenic
1108972013 13:56388322-56388344 GAGTGGGTAGGGATGGAGAAAGG - Intergenic
1109184846 13:59255702-59255724 AAGTGGGGAGTGAGGAAAGAAGG + Intergenic
1109881812 13:68487839-68487861 AAGTGGGTGGGGAAGGAGAAAGG - Intergenic
1109909715 13:68893304-68893326 GAGAGGGTAAAGAGGGAGAAAGG - Intergenic
1110102741 13:71630394-71630416 TAGTTGTTAGAGAGGCAAAATGG + Intronic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1110800020 13:79683907-79683929 ACGTGGAGAGAGAGAGAAAAAGG - Intergenic
1111026406 13:82532685-82532707 AAGAGGTATGAGAGGGAAAAGGG - Intergenic
1111108889 13:83681642-83681664 AAAAGACTAGAGAGGGAAAAAGG - Intergenic
1111149770 13:84235150-84235172 AAGTGGGTAAAGCGGGACACTGG + Intergenic
1111331405 13:86764412-86764434 AAATGGTCAGAGAGGGAGAAGGG + Intergenic
1111585878 13:90284305-90284327 GAGTGGGCAGAGAAGGAAAAAGG + Intergenic
1111899181 13:94180106-94180128 AAGGGAGTAGAGAGGGTACAAGG + Intronic
1112050029 13:95635935-95635957 AAGGAGGTAGGGAGGGAAAGAGG + Intronic
1112187515 13:97142073-97142095 AAATTGATAGAGAGGGAAAAGGG + Intergenic
1112922942 13:104637646-104637668 AAGAGGGAAGAGGGGTAAAAGGG + Intergenic
1112949742 13:104977981-104978003 GACTGGGAAGAGAGGGAAAAAGG - Intergenic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1114200066 14:20511742-20511764 AGGTGGGAAGAAAGAGAAAAGGG - Intergenic
1114533920 14:23411521-23411543 AAGGGGGTAGGGAGGGGACAAGG - Intergenic
1114733902 14:25023417-25023439 AATTGGGAAGAGATGGAAAATGG - Intronic
1114797254 14:25730118-25730140 GAGGGGGTAGTGAGTGAAAAGGG - Intergenic
1114859953 14:26504885-26504907 ATGTGTGTACAAAGGGAAAAGGG + Intronic
1115801279 14:36996704-36996726 AAGTGGATGGAGAGGGAGAGTGG + Intronic
1115851011 14:37590560-37590582 CTGTGGGTAGAGAGGACAAAGGG + Exonic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1116195657 14:41722588-41722610 GAGTGGGGACAAAGGGAAAAGGG - Intronic
1116239982 14:42328272-42328294 AAGGTGATAAAGAGGGAAAAAGG - Intergenic
1116251388 14:42487429-42487451 AGATGGGTAAAGAAGGAAAAAGG + Intergenic
1116405546 14:44561209-44561231 AAGTGAATAAAGTGGGAAAAGGG - Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116429853 14:44833718-44833740 AAGTGTTTAGAGAAAGAAAAGGG - Intergenic
1116836191 14:49770545-49770567 AAGTGGCTAGGGAGGGTCAAAGG + Intronic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117556621 14:56892993-56893015 AGGAAGGGAGAGAGGGAAAATGG - Intergenic
1118129913 14:62951422-62951444 AAATAGGCAGGGAGGGAAAATGG + Intronic
1118137844 14:63047220-63047242 AGGTGGGAAGAGAGAGAAAGGGG - Intronic
1118294309 14:64554832-64554854 AAGTGTGTGGAGTGGGTAAAGGG + Intronic
1118369757 14:65127786-65127808 AAGGAGGGAGAGAGGGAAAAAGG - Intergenic
1118554472 14:67000278-67000300 AAGAAGGGAGAGAGGAAAAAAGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1119424413 14:74526586-74526608 GAGTGGGCAGAGGGTGAAAAAGG + Intronic
1119872883 14:78032021-78032043 CAGTGGGTAGAGAGAAAGAAAGG + Intergenic
1120016050 14:79474813-79474835 AAGAAGGAAGAGAGGGAAAGAGG + Intronic
1120037924 14:79718994-79719016 AAGTGTGTAAAAAGTGAAAAAGG - Intronic
1120219187 14:81713460-81713482 AAGTGAGCAGAGAGGGAGAAAGG + Intergenic
1120280231 14:82429853-82429875 AAGTGGGGAGGGAGGGGACAGGG - Intergenic
1120366214 14:83573796-83573818 AATTGGGATGAGAGAGAAAAGGG + Intergenic
1120687619 14:87556245-87556267 GAGGGAGTGGAGAGGGAAAAGGG + Intergenic
1121447215 14:93986905-93986927 AAGTGGGAAGTAAGGGAGAAAGG - Intergenic
1121586628 14:95067456-95067478 AAGTGAGCAGAGAGGGCAAGTGG - Intergenic
1121832681 14:97065744-97065766 CAGTAGGCAGAGAAGGAAAAGGG + Intergenic
1121865020 14:97354872-97354894 AAGTTCCTAGAGAGGGATAAAGG - Intergenic
1121990457 14:98552044-98552066 AAGAGGGTAGAGAGGAAGAAAGG + Intergenic
1122250341 14:100434736-100434758 AGCTGGGTAGAGAGGAAAAAGGG - Intronic
1123156730 14:106234456-106234478 AAGTATGCAGAGAAGGAAAATGG + Intergenic
1123207503 14:106727557-106727579 AAGTATGCAGAGAAGGAAAATGG + Intergenic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1123691186 15:22839299-22839321 AATTGTATAGAGAGGGAAATAGG - Intronic
1123968284 15:25480502-25480524 AAGTGGCAAGAGAGGAGAAAGGG + Intergenic
1124100391 15:26687560-26687582 AGGAAGGGAGAGAGGGAAAAGGG - Intronic
1124140274 15:27071287-27071309 AAGGGGGTAGGGTGGCAAAAGGG - Intronic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124457751 15:29859938-29859960 AAGAGGGGAGAAAAGGAAAAAGG + Intronic
1124650062 15:31467844-31467866 AAGTGGAAAGAAAGGGAAAGTGG + Intergenic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1125697507 15:41651679-41651701 AAGGGGTAAGAGAGGGGAAAGGG - Intronic
1126257461 15:46644437-46644459 AAGTGGAAAGGGAGGGGAAATGG + Intergenic
1126567806 15:50117958-50117980 ATGAAGGTAGAGAGGGAGAATGG + Intronic
1127217997 15:56845232-56845254 AAGGGGGGAGAGGAGGAAAAGGG - Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127902002 15:63347868-63347890 AGGTGGGTAAATAGAGAAAAGGG + Intronic
1128362467 15:66972080-66972102 AACTGGGTATAGAGGGACAATGG + Intergenic
1128612441 15:69084764-69084786 ATGTGATTAGAGAGGGAAAGAGG - Intergenic
1128803389 15:70512618-70512640 GAGTGGGGAGAGAGGGAGAGGGG + Intergenic
1128884316 15:71272429-71272451 AAGTGGGGAGGGAGGGGCAAAGG + Intronic
1129003574 15:72353829-72353851 ATTTGGGTACACAGGGAAAATGG + Intronic
1129647271 15:77448182-77448204 ATGAAGGTGGAGAGGGAAAAGGG - Intronic
1130077854 15:80705108-80705130 AAGAGGCAAGAGAGGGAAGATGG + Intronic
1130198823 15:81806607-81806629 AAGTTGTGAGAGAGAGAAAAAGG - Intergenic
1130354510 15:83117422-83117444 GAGAAGGTAGAGAGAGAAAAGGG + Intronic
1130775003 15:86969749-86969771 AAGTGGGAAGAAGGAGAAAATGG + Intronic
1131128128 15:89873613-89873635 GAATGGGCAGAGATGGAAAATGG - Intronic
1131305666 15:91240927-91240949 TAGTGAGGAGAGAGGGAGAATGG - Intronic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1132029291 15:98427301-98427323 AAGAGGGAAGAGAGGGAACAAGG - Intergenic
1132206187 15:99987756-99987778 GAGAAGGCAGAGAGGGAAAACGG + Intronic
1132638467 16:965779-965801 AGGTGGGTAGAGGGGAAAGAAGG + Intronic
1134852814 16:17495413-17495435 GAGTGGGCAGAAAGTGAAAATGG - Intergenic
1134886818 16:17800508-17800530 AGAAGGGTAGAGAGGGAAAGGGG - Intergenic
1135053818 16:19214036-19214058 TAGTGGGTAGAGAGAGACCAGGG - Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135881701 16:26263805-26263827 AATTGGATAGCAAGGGAAAAAGG - Intergenic
1135985762 16:27182825-27182847 ATGGGGGTAGGGAGGGAGAAAGG + Intergenic
1136074326 16:27806481-27806503 AATTGGGCAGAGAGGAAAAGTGG + Intronic
1136270962 16:29148040-29148062 ACGTGAGGAGTGAGGGAAAAAGG - Intergenic
1136358233 16:29760704-29760726 TAGAGGGAGGAGAGGGAAAAGGG - Intergenic
1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137800970 16:51261947-51261969 AAGAAGGGAGAGAGGGAAGAAGG - Intergenic
1137854663 16:51782168-51782190 AAGTGGGGAGACAGGCAAAAAGG - Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138541935 16:57693544-57693566 AAGTGGGTATGAAGAGAAAAAGG + Intergenic
1138781865 16:59798091-59798113 AAGGGAGTAGAGAGTGACAAGGG - Intergenic
1139308151 16:66005739-66005761 AAGTGGGTGGGGAGCGAGAAAGG - Intergenic
1139435410 16:66934065-66934087 ATGTGGGAAGTGAAGGAAAAGGG + Exonic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1140464479 16:75168975-75168997 AAGTGGGCAGAGAGGGTGAAAGG - Intronic
1140791986 16:78400652-78400674 AAGCAGGTAGAAAGGGAACAGGG + Intronic
1141051042 16:80763945-80763967 AAGGGGGTAGAGAGGGAAAGAGG + Intronic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141292062 16:82727455-82727477 TCCTGGGTAGAGAGGGAATAAGG - Intronic
1142074574 16:88110064-88110086 ATGTGAGGAGTGAGGGAAAAAGG - Intronic
1142738808 17:1918334-1918356 AAGGGGGTAGAGAGAGAAGAAGG - Intergenic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143714216 17:8755617-8755639 AAGGGAGTAGAGAGAGAGAAAGG + Intronic
1143964189 17:10744926-10744948 AGGAGGGGAGAGAGGGAAAGGGG + Intergenic
1144247757 17:13384356-13384378 AAGGGGGGAGAGAGGGAAGGAGG + Intergenic
1144796343 17:17893814-17893836 ATGTGGGGAGGGAAGGAAAAGGG + Intronic
1144887930 17:18476696-18476718 AAGTGGGTCCAGAGAGAGAAAGG - Intergenic
1145036204 17:19542372-19542394 AACTGGGAAGAGAGGGGAACGGG - Exonic
1145144278 17:20467605-20467627 AAGTGGGTCCAGAGAGAGAAAGG + Intergenic
1145175729 17:20699005-20699027 AAGTGGGTCCAGAGAGAGAAAGG + Intergenic
1145413913 17:22696754-22696776 GAGTGGTTAGAGAGGGGAACAGG - Intergenic
1145414246 17:22702003-22702025 GAGTGGTTAGAGAGGGGAACAGG + Intergenic
1145791585 17:27631107-27631129 AAGTGGGTCCAGAGAGAGAAAGG - Exonic
1146207950 17:30921132-30921154 AAGATGGGAGAGAGGGAAAGAGG + Intronic
1146479935 17:33197103-33197125 AAATGGGTAGAGAGTGAAGGTGG + Intronic
1146552836 17:33796740-33796762 AAGTATGAAGTGAGGGAAAAAGG + Intronic
1146743515 17:35306910-35306932 AAGAGGGGAGAGAGGGAGAGAGG - Intergenic
1146914003 17:36666504-36666526 GAGGAGGAAGAGAGGGAAAAAGG + Intergenic
1146963079 17:37001366-37001388 GAGAGGGGAGAGAGAGAAAAAGG + Intronic
1147516483 17:41122640-41122662 AAGGGGGGAGAGAGGGAGAGAGG + Intergenic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1147772964 17:42880172-42880194 GAGGGGGTGGAGAGGGAATAGGG + Intergenic
1148143197 17:45342732-45342754 AAGAGGGGAGAGAAGGAAAGGGG + Intergenic
1148955091 17:51347038-51347060 AAATGTGGAGAGTGGGAAAAGGG + Intergenic
1149148546 17:53530657-53530679 AAGGAGGGAGAGAGGGAGAAAGG + Intergenic
1149273934 17:55013982-55014004 AGCTGGGTATAGAGGGACAACGG + Intronic
1149418237 17:56482885-56482907 AAGTGGGGAGAGAGAGGGAAGGG - Intronic
1149520436 17:57314491-57314513 CAGTGGCAAGAGATGGAAAAGGG + Intronic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1150668951 17:67172504-67172526 AAGTGGCTAAAGTGGGAATATGG - Intronic
1150714907 17:67563867-67563889 ATGTGGGGAGAGAGAGAAATGGG + Intronic
1151016191 17:70555880-70555902 AAGGAGGGAGAGAGGGAGAAAGG + Intergenic
1151112408 17:71694392-71694414 AAAAGAGTAGAGAGGGAGAATGG + Intergenic
1151267705 17:72969352-72969374 GAGAGAGGAGAGAGGGAAAAAGG + Intronic
1151377900 17:73704001-73704023 AAGGGGGAAGGGAGGGAGAAAGG - Intergenic
1152228474 17:79103354-79103376 GAGTGGGGAGAGAGAGAGAAGGG + Intronic
1152790861 17:82278750-82278772 AAGTGGGAAGAGGGGAGAAAGGG + Intergenic
1153380654 18:4435489-4435511 AAGGGGGAAGAGAGGGGAAACGG + Intronic
1153401699 18:4689456-4689478 AGCTGGGTATAGAGGGACAATGG - Intergenic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1155367572 18:25063790-25063812 AAGTGAGTAGTGAGAGAACATGG - Intronic
1155695066 18:28675325-28675347 AAGTTGGCAGACAGGTAAAATGG + Intergenic
1155789969 18:29953214-29953236 AAATGGGTAGAAAGGAAAACAGG - Intergenic
1155995212 18:32323933-32323955 AAATGGGGAGAGAGGGAGATAGG + Intronic
1156047432 18:32892793-32892815 GAGTGGGTAGAGTTAGAAAAGGG + Intergenic
1156210293 18:34932750-34932772 AAGTTTGTAGTAAGGGAAAAAGG + Intergenic
1156354361 18:36328747-36328769 AAGTGGGAAGAGAGGGGTCAAGG + Intronic
1156370178 18:36466022-36466044 GAGAGGGCAGAGAGGGGAAAAGG - Intronic
1156432068 18:37085797-37085819 GAGAGGGAGGAGAGGGAAAAAGG - Intronic
1156521489 18:37725653-37725675 AGGTGGGCAGAGAGGAGAAAAGG - Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156814442 18:41292649-41292671 AAGTTGGGAGAGATGAAAAAAGG - Intergenic
1157084541 18:44565791-44565813 AAGAAGGAAGAGAGGGAAAGAGG + Intergenic
1157958638 18:52127212-52127234 AAATAGGTAGAGAAAGAAAAGGG - Intergenic
1158283260 18:55850937-55850959 AACTGGATAGAGAGAGAAAAAGG + Intergenic
1158453294 18:57586091-57586113 AAGTGGGCACAGAGGGACCAAGG + Intronic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159300980 18:66567293-66567315 AAGGAGGAAGAGAGGGAATAAGG + Intronic
1159401402 18:67940570-67940592 ATGAGGATAGAGAGGCAAAAGGG + Intergenic
1159673587 18:71253367-71253389 AACAGGATAGAGAGGGAGAAAGG - Intergenic
1159726995 18:71973563-71973585 AAGAGAGAACAGAGGGAAAAGGG + Intergenic
1159991291 18:74911864-74911886 AAGTGGGGAGATAAGCAAAATGG + Intronic
1160035531 18:75298308-75298330 AAGGGGGTAGACAGGTAAAGGGG - Intergenic
1160085853 18:75777119-75777141 AAGAGAGGAGAGAGGGAAAAGGG - Intergenic
1161215397 19:3092674-3092696 AGGAGGCCAGAGAGGGAAAAGGG + Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161859198 19:6785004-6785026 CAATGGGTAGAGAGGGAGCAGGG - Intronic
1161880802 19:6950591-6950613 AAGTTGGAAGGGAGGAAAAATGG + Intergenic
1162395349 19:10415354-10415376 AGGGGGGAAGAGCGGGAAAAGGG + Intronic
1162404452 19:10465176-10465198 TAGTGGGTAGAGAGAGACCAGGG - Intronic
1163389809 19:17023495-17023517 AAGAGGGTAAAGGGGGAAACTGG + Intronic
1164173708 19:22749485-22749507 AGCTGGGTATAGAGGGACAACGG - Intergenic
1164654340 19:29909997-29910019 AAGGGGGGAGAGAGGGAGAGAGG - Intergenic
1164654365 19:29910077-29910099 AAGGGGGGAGAGAGGGAGAGAGG - Intergenic
1164654390 19:29910157-29910179 AAGGGGGGAGAGAGGGAGAGAGG - Intergenic
1164654522 19:29910614-29910636 AAGGGGGGAGAGAGGGAGAGAGG - Intergenic
1164654598 19:29910906-29910928 AAGCGGGGAGAGAGGGAGAGAGG - Intergenic
1164859421 19:31551163-31551185 AAGAGGGGAGAGAAGGAGAAGGG - Intergenic
1165401055 19:35600565-35600587 AAGTAGGGAGAGAGTGAGAAAGG + Intergenic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165584804 19:36904869-36904891 AAGTTGGTAGGGAGGAAAAGTGG + Intronic
1165767742 19:38361558-38361580 AAGTGGGTGGGGTGGGAAAGAGG + Intronic
1166321434 19:42021566-42021588 AAAGGGGGAGAGATGGAAAAAGG + Intronic
1166784449 19:45359282-45359304 TAGTGGGTAGAGAATGACAAAGG + Intronic
1167764611 19:51473185-51473207 AAGTGGATAGAGAGGGTGAGAGG + Intergenic
1167867870 19:52342984-52343006 GGGTGGGTGGAGAGGGAAAATGG - Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1202697455 1_KI270712v1_random:135398-135420 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
924973984 2:156535-156557 AGCTGGGTATAGAGGAAAAACGG + Intergenic
925501793 2:4513072-4513094 ATGTGGGTAGTGAGGAAAAACGG + Intergenic
925623880 2:5822457-5822479 AAGTAGTAAGAGTGGGAAAAAGG - Intergenic
925817628 2:7768905-7768927 ACGTGGCTAGAGAAGGAGAAAGG - Intergenic
925894742 2:8462732-8462754 GAGCGGGTAGAGATGGAAATTGG + Intergenic
926223777 2:10953316-10953338 GAGTGGGTAAAGAGGGGATAGGG + Intergenic
926231518 2:11007772-11007794 AATTGGGCAGAGGGTGAAAAGGG - Intergenic
926643846 2:15266742-15266764 AAGTAGGTAGAGAAGGAAGGAGG - Intronic
926847488 2:17158441-17158463 AACTGGTTAGAGAGAGGAAAAGG - Intergenic
927066796 2:19479998-19480020 AAGAGAGTTGAGATGGAAAAGGG + Intergenic
927343564 2:22010237-22010259 GAGGGGATAGAGAGGGGAAAGGG - Intergenic
927374743 2:22400879-22400901 AAGGGAGTAGAAAGGGCAAAGGG - Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927695007 2:25233840-25233862 AAGGTGGGAGAGAGGAAAAAAGG - Exonic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927746386 2:25625728-25625750 AAGAGGGCAGAGATGGCAAAAGG - Intronic
928042912 2:27896422-27896444 AAGTGGAGAGAGATGGGAAATGG - Intronic
928347997 2:30518647-30518669 AGCTGGGTATAGAGGGACAACGG - Intronic
928677197 2:33661571-33661593 AGCTGGGTATAGAGGGACAACGG - Intergenic
929223339 2:39487930-39487952 AAAGGGGGAGGGAGGGAAAAAGG - Intergenic
929414176 2:41730336-41730358 AAGAGGGGAGAGAGGGGAATGGG - Intergenic
929460170 2:42097559-42097581 AGGTGGGTACAGAGGAATAATGG - Intergenic
929579345 2:43071788-43071810 AAGTGGGGAAAGAGGGGAAGAGG - Intergenic
930311876 2:49752370-49752392 AAGAGGGGAGAGAGGGAAAGAGG + Intergenic
930406727 2:50967649-50967671 AAATGGGAAGAGAGGGCAAAAGG + Intronic
930579044 2:53187485-53187507 AAGAGGTTTGAAAGGGAAAAGGG + Intergenic
930648338 2:53936732-53936754 AGGGGGGAAGAAAGGGAAAAAGG + Intronic
930837309 2:55808058-55808080 AAGTGGGTAGAGAGAGGCCAGGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932278562 2:70470175-70470197 AAGAGGGGAGGGAGGGAAACAGG + Intronic
932481384 2:72041606-72041628 AAGAGGGCAGAGAGGGAGAGAGG + Intergenic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932583074 2:73005133-73005155 AAGTGGAAGGAGAGGGAAACAGG + Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
932962845 2:76435283-76435305 AGCTAGGTAGAGAGGGAGAAGGG + Intergenic
933158017 2:78995191-78995213 AAGTGGGGAGAGAATGAAGATGG - Intergenic
933427816 2:82135494-82135516 AAGATGGAAGAGAGGGAACAGGG - Intergenic
933532228 2:83525217-83525239 AAGTGGGGAGGGTGGGAATAGGG + Intergenic
934278625 2:91592422-91592444 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
934549574 2:95248345-95248367 AAGTGGGGAGAGAGAGGCAAGGG + Intronic
935529507 2:104215600-104215622 AGGTAGATAGAGAGGAAAAAGGG + Intergenic
935719338 2:105966497-105966519 AAGCAGGGAGAGAGGGAAAGTGG + Intergenic
935748840 2:106212761-106212783 AGCTGGGTATAGAGGGACAATGG - Intergenic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
935959802 2:108413739-108413761 AAGTGGGAAGAAGGGGGAAATGG + Intergenic
936880514 2:117244779-117244801 AAGCGGGAAGAGAGGGACAAAGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
936963237 2:118099019-118099041 AAGTTGCCAGAGATGGAAAATGG + Intronic
937096538 2:119239209-119239231 AAACGTGTAGAGAGGGAAAGAGG - Intronic
937134534 2:119541562-119541584 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937610080 2:123850584-123850606 CAGTAGGAAGAGAGGGCAAAGGG - Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937851583 2:126640831-126640853 ACGTGGGTAGAGAGAGAGAGAGG - Intergenic
938122638 2:128644737-128644759 AATGAGGTAGAGAGGGAGAAAGG - Intergenic
938219305 2:129551868-129551890 AGGTGAGCAGAGAGAGAAAAGGG + Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938698801 2:133858401-133858423 GAGAGGGGAGAGAGGGAAAGAGG + Intergenic
939007023 2:136801026-136801048 CAGTGGGTAAAGAGGGACAAAGG - Intronic
939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG + Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939240526 2:139553191-139553213 AAGTTAGGAGATAGGGAAAATGG - Intergenic
939647526 2:144719152-144719174 AAGCAGGAAGAGAGAGAAAAGGG + Intergenic
940039989 2:149350191-149350213 AAGTGGGGAGAGGGGACAAAAGG - Intronic
940330121 2:152465430-152465452 AAGTGGTTAAAGTGGGACAAAGG + Intronic
940362995 2:152815738-152815760 AAGTGGTTAAAGAGGTGAAAAGG + Intergenic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
941434967 2:165458623-165458645 AAGTGGGGAGAAAGGGAGAGGGG - Intergenic
941770647 2:169341881-169341903 AAGTGAATAGAGAGGCAGAAAGG - Intronic
942004580 2:171685310-171685332 AGGTGGGTAGAAAGGGAAATTGG - Intergenic
942617819 2:177812798-177812820 AAGCGGGTAAAGAGGGAAAAAGG + Intronic
942634423 2:177987232-177987254 AAGGGGATGAAGAGGGAAAAGGG + Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
942863628 2:180646299-180646321 AAGTGTTTTGAGGGGGAAAAGGG - Intergenic
943184547 2:184590405-184590427 AAGGGGTAAGGGAGGGAAAAAGG - Intergenic
944401119 2:199327731-199327753 AAGTGTGTGGAGAGGAAGAATGG + Intronic
944452012 2:199852825-199852847 AAGTGAGTAGAGTGGAGAAAGGG - Intergenic
944532092 2:200677217-200677239 AAGGAGGGAGGGAGGGAAAAAGG + Intergenic
944655163 2:201870213-201870235 AAATGGGCAAAGAAGGAAAAAGG + Intronic
944731713 2:202524034-202524056 GAGTGGGGAGAGAGGGAGAGGGG + Intronic
944867010 2:203872173-203872195 AAGAAGGGAGAGAGGGAGAAGGG - Intronic
945012589 2:205481053-205481075 AAGGAGGTGGAGAGGGAAACAGG + Intronic
945065830 2:205946888-205946910 ATGTGGGTAGAGAGAAAAAGAGG + Intergenic
945108994 2:206344778-206344800 ACGTGGCAAGAGAGGGAACAAGG - Intergenic
945239401 2:207662377-207662399 CAGAGGGCAGAAAGGGAAAAGGG - Intergenic
945958061 2:216104890-216104912 GAGTGGGGAGAGAGGGAGAGAGG + Intergenic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
946565167 2:220956529-220956551 AAGTGGTGAAAGAGGGATAAAGG - Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947971865 2:234331546-234331568 ACGTGGGGAGGGAGGGAAAGAGG - Intergenic
948707739 2:239805526-239805548 AAGGGGGCAGCGAGGGAAATTGG + Intergenic
948773436 2:240265426-240265448 GAGTGGGGAGAGAGGGAAAGAGG - Intergenic
1168944895 20:1745080-1745102 AAGATGTTAGAGAAGGAAAATGG + Intergenic
1169213138 20:3778623-3778645 AAGGGGCTAGAGGGGGAGAAGGG - Intronic
1169574068 20:6938931-6938953 AAGAAGGAAGAGAGGGAAAGAGG - Intergenic
1169710641 20:8558486-8558508 AAGTGAGGAGAGAGAAAAAAAGG + Intronic
1170264860 20:14454729-14454751 AAGAGTGTAGAGACAGAAAAAGG - Intronic
1170391898 20:15884287-15884309 AGGTGAATAGAGAGGGAGAAGGG + Intronic
1170501867 20:16982613-16982635 AAGTGGGGAGGGAGGAAGAAGGG - Intergenic
1171155239 20:22866008-22866030 AAATAGGGAGAGAGAGAAAAAGG + Intergenic
1171496339 20:25558597-25558619 AAGTTGGTCAAGAAGGAAAAAGG - Intronic
1172813609 20:37669449-37669471 AGGTGAGAAGACAGGGAAAAAGG - Intergenic
1172951729 20:38726845-38726867 AATAGGGTAGAGAGGGAGAGGGG - Intronic
1173041206 20:39464728-39464750 CTGTGGGTAGAGGGGAAAAAAGG - Intergenic
1173219038 20:41116140-41116162 AAGTGGGAAGTTAGGGAAAGAGG - Intronic
1173355776 20:42288507-42288529 AAGTGGGGAAAGAGGGAGAGAGG - Intronic
1173544153 20:43879856-43879878 AAATGGGTAGGAAGGGAGAACGG - Intergenic
1173584528 20:44172261-44172283 AATTGGGGTGAGAAGGAAAAAGG + Intronic
1173761309 20:45562934-45562956 AGGTGGGTAGAGGGAGAAAGAGG + Intronic
1174105611 20:48160519-48160541 AAGGGGGTTTAGAGGGAACATGG - Intergenic
1174772928 20:53318207-53318229 CAGGAGGTAGAGAGAGAAAAGGG + Intronic
1174945093 20:54976313-54976335 GGGTGGTTAGAGAGAGAAAAAGG + Intergenic
1174977264 20:55349629-55349651 AGCTGGGTATAGAGGGACAATGG - Intergenic
1175773533 20:61638667-61638689 ATGTGGGCAGAGAGGAAGAAAGG - Intronic
1176107363 20:63395728-63395750 AAGAGAGTAGAGAGGGAAGAAGG + Intergenic
1176213412 20:63936906-63936928 AAATGGGGAGAGACGCAAAACGG - Intergenic
1177192669 21:17869234-17869256 ATGTGGGTAGAAGGGGAGAAAGG + Intergenic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1177263360 21:18755758-18755780 AGCTGGGTATAGAGGGACAACGG + Intergenic
1177564737 21:22805457-22805479 AAGTTGGTAGAGAGTGAGAGTGG - Intergenic
1177741364 21:25158064-25158086 AAGTGTGGGGAGAGAGAAAAAGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179215880 21:39366851-39366873 AAGGGGGAAGGGAAGGAAAAAGG - Intergenic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181950602 22:26550931-26550953 GAGTGGTTCAAGAGGGAAAAAGG + Intronic
1182402066 22:30086144-30086166 AAGGAGGAAGAGAGGGAAAGGGG - Intronic
1182446719 22:30393959-30393981 AAGTGTGTGGAGAGGGCAAGTGG + Intronic
1182495736 22:30706062-30706084 AAGGGGAAAGAGAGGGGAAATGG + Intronic
1182948452 22:34347934-34347956 AACAGGGTGGAGAGGGAAGAGGG + Intergenic
1183230422 22:36578636-36578658 AGGTGGGGAGAGAGGGGCAATGG + Intronic
1183750980 22:39720155-39720177 AAGTGGGGAGTGAAAGAAAATGG + Intergenic
1183766589 22:39882317-39882339 AGTTGGGGATAGAGGGAAAAAGG + Intronic
1184013628 22:41768674-41768696 AAGGAGGAAGAGAGTGAAAAGGG + Intronic
1184319454 22:43729071-43729093 AAGTGGCAAGAGAGGGAGCAAGG + Intronic
1184863805 22:47191711-47191733 AGGGGGGGAGAGAGGGAGAAAGG + Intergenic
1185102596 22:48849687-48849709 AAGTTGGGAGAGAGGAAGAAAGG + Intronic
1185102607 22:48849753-48849775 AAGCAGGTGGAGAGGGAGAAAGG + Intronic
949128839 3:477244-477266 AAGTGTATAGAGAAGGATAATGG - Intergenic
949563965 3:5228371-5228393 AAGGAGGAAGAAAGGGAAAAAGG - Intergenic
949607468 3:5670100-5670122 AGGTGGGGAGAGAGGGGATAAGG + Intergenic
949797261 3:7864512-7864534 AAGAAGGTAGAGAGGGAACAGGG - Intergenic
949807713 3:7973947-7973969 AAGAAGGAAGGGAGGGAAAAAGG + Intergenic
950173558 3:10855867-10855889 AAGAGAGGAAAGAGGGAAAAGGG - Intronic
950758583 3:15199758-15199780 AAGTGGGTAGCGTGGGAAAGAGG + Intergenic
951101889 3:18698219-18698241 ACGTGGGGAGAGAGGGACCAGGG + Intergenic
951483155 3:23183158-23183180 AATTGGGCAGAGAGAAAAAATGG + Intergenic
951708664 3:25568498-25568520 AAGGGGGAAGAAAGGAAAAAAGG - Intronic
951838072 3:27003998-27004020 AGCTGGGTATAGAGGGACAATGG - Intergenic
952009395 3:28883048-28883070 AAGTGAGTAGACAAAGAAAAGGG + Intergenic
952078807 3:29731928-29731950 AGATGGGGAGAGAGGGAAATGGG - Intronic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
952869564 3:37886314-37886336 AAGTGGGTCGGGAGGGAAATGGG - Intronic
953026009 3:39145357-39145379 AAATGGGTGGAGAGGGAGGAGGG - Intronic
953397811 3:42586991-42587013 AAGTGGGGAGGGAAAGAAAAGGG - Intronic
953583909 3:44182419-44182441 AAGTGGGTATAGTGGGGAAGGGG + Intergenic
953589587 3:44238601-44238623 ACATGGGTAGAAAAGGAAAAGGG + Intergenic
953806852 3:46077927-46077949 GAGTGGGGAGAGAAGGAAAGGGG + Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954407407 3:50353115-50353137 CAGTGGGGAGAGAAAGAAAAAGG + Intronic
954560161 3:51549794-51549816 AAGGGGGTGGGGAAGGAAAATGG + Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955185209 3:56708668-56708690 AAGTTGGTAAAGAGAGAAAGTGG + Intergenic
955281716 3:57600426-57600448 AAGGGGGAAGGGAGGGGAAAAGG - Intergenic
955591948 3:60546522-60546544 AAGTGGGGAGAGAGGGATGGTGG - Intronic
955630656 3:60970579-60970601 AAGCTGATAGAGGGGGAAAATGG - Intronic
955740662 3:62088094-62088116 AAGTGGGGAGGGAGGGAATGGGG + Intronic
955832640 3:63020593-63020615 AAATGGGAAGAGAGGGAAAGAGG + Intergenic
956185361 3:66557233-66557255 GAGTGGGTAGATGGGGAAAAGGG + Intergenic
956510265 3:69985646-69985668 AAGAAGGTAGGGAGGGAGAAGGG + Intergenic
956744503 3:72300823-72300845 ATGGGGGTAGAGAGGTAAATGGG - Intergenic
957226612 3:77456922-77456944 AAATGGGGAGAGAGGGAAATTGG - Intronic
957327818 3:78718857-78718879 AGGGAGGGAGAGAGGGAAAAAGG + Intronic
957397498 3:79661042-79661064 AAGTAGATAGAGAGGCACAAAGG + Intronic
957784533 3:84864603-84864625 AATTTGGTAGAGAAGGAAATGGG + Intergenic
957857643 3:85898443-85898465 GAGTGGGCAGAGAAGGCAAAGGG - Intronic
957965168 3:87312842-87312864 AAGTTAGTAGAGAGGAAAATTGG - Intergenic
958016090 3:87941806-87941828 AGCTGGGTATAGAGGGACAATGG + Intergenic
958268509 3:91469105-91469127 AAGTTCTTAGAGAGGGGAAAAGG - Intergenic
959097954 3:101976169-101976191 TAGTGGGGAGAGAGGGAATGGGG + Intergenic
959188442 3:103077920-103077942 AAGTAGGAAGAGAGAGAAAAGGG - Intergenic
959537641 3:107504740-107504762 CATGGGGCAGAGAGGGAAAATGG + Intergenic
959847526 3:111051715-111051737 AAGTGGCCAGAAAGGAAAAAGGG - Intergenic
959852253 3:111102300-111102322 AAGTGGGGTGAGGTGGAAAATGG - Intronic
960297584 3:115962700-115962722 AAGTGAGTAGAAAAGGGAAAGGG + Intronic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961075945 3:123981861-123981883 AAATCTGTAGAGAGGAAAAAAGG + Intronic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
961927535 3:130497095-130497117 TAGGGGGTAGAGAGGGATTAGGG - Intergenic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
961999939 3:131285282-131285304 GAGTGGGTAGAGAGAGAAGGTGG + Intronic
962937699 3:140096265-140096287 AATTGGCCAGAGAGGGAAACAGG - Intronic
963071425 3:141308446-141308468 ATGGGGGAAGAGAGGGAAACTGG - Intergenic
963210695 3:142686503-142686525 AAGTTTGTAGAGATGGATAATGG - Intronic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963892966 3:150656515-150656537 GAGTGGGTAGTAAGGGAAAGAGG + Intergenic
964140223 3:153390039-153390061 TAGTGGGTGTAGGGGGAAAAGGG - Intergenic
964253165 3:154743860-154743882 AGGAGAGGAGAGAGGGAAAAGGG + Intergenic
965054645 3:163697493-163697515 AGCTGGGTATAGAGGGACAATGG + Intergenic
965291392 3:166886274-166886296 TAGTGGGGAGAGAGGGATATGGG + Intergenic
965370878 3:167861035-167861057 AGGTGGGAGGAGAGGGATAAAGG - Intergenic
965941769 3:174192809-174192831 AAGTTGCTAGGGAGGGAAATTGG - Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966514483 3:180802632-180802654 AAAAGGGTGGAGAGGGAAAGGGG + Intronic
967248398 3:187512522-187512544 CAGAGGGCAGAGAGGGAAAGAGG + Intergenic
967305303 3:188053321-188053343 AACTGGTCAGACAGGGAAAAGGG - Intergenic
967381964 3:188868949-188868971 AAGTGTGCAGACAGGGAGAAAGG + Intronic
968143181 3:196275391-196275413 AAGAGGGTGGAGAGCAAAAAGGG + Intronic
968920419 4:3519434-3519456 AAGGGGGCAGAGAGGGAGAGAGG - Intronic
968929288 4:3570041-3570063 CAGTGGTTAGAGACAGAAAATGG - Intergenic
969605686 4:8201259-8201281 AAGTGGGTCGAGTGGGTTAAAGG - Intronic
969810593 4:9644597-9644619 ATTTGGGTAGGGAAGGAAAAAGG - Intergenic
970122752 4:12775205-12775227 AAGTAGCTAGAGATGGAAGATGG - Intergenic
970192333 4:13528524-13528546 AAGTGGGTAGAGGGTGAGGAGGG + Intergenic
970208344 4:13679595-13679617 AAAGGGGTAGGGAGAGAAAAGGG + Intergenic
970673603 4:18423012-18423034 AAGTGGGGGAAGATGGAAAATGG - Intergenic
971653242 4:29306951-29306973 TAGTGAGGAGACAGGGAAAATGG - Intergenic
971656390 4:29351513-29351535 AAGTGGGGAGAGTGGGAGAGAGG - Intergenic
972061634 4:34881636-34881658 AAGGAGGGAGAGAGGGAGAAAGG - Intergenic
972159359 4:36204079-36204101 TAGTGAGCAGAAAGGGAAAATGG + Intronic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
972692625 4:41414360-41414382 AAGGGGGTAGATCGGGATAACGG - Intronic
974755379 4:66199512-66199534 AAGAAGGGAGAGAGGAAAAAAGG - Intergenic
974882410 4:67775894-67775916 GAGTGGGAAGAAAAGGAAAAGGG - Intergenic
974915781 4:68176539-68176561 AATTGGGTAGAAAAGGGAAAAGG - Intergenic
974989974 4:69075420-69075442 AAGTGTGTAGAGGGAGAAAAAGG - Intronic
975163505 4:71150674-71150696 AAGTGTGCAGAGATGGAAATGGG + Intergenic
975313656 4:72929113-72929135 AGCTGGGTATAGAGGGACAACGG + Intergenic
975436116 4:74353803-74353825 AAGTGGGCAGGAAGGGAAAGGGG + Intergenic
976108199 4:81641894-81641916 GAGTGGGTAGAGATGGGACAAGG - Intronic
976152548 4:82106778-82106800 AAGCGGGTAGAGTGGGAGGAAGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976489836 4:85657537-85657559 AAAGGAATAGAGAGGGAAAATGG + Intronic
976518735 4:86002353-86002375 AATTGGAAAGAGAGAGAAAAGGG - Exonic
976521764 4:86035958-86035980 ATGTGGGTATAGAGAGTAAATGG + Intronic
976727576 4:88229657-88229679 AAGTGGGGAGAAAAGGAGAATGG - Intronic
977578426 4:98699292-98699314 AAGGGGTTAGATAGAGAAAATGG - Intergenic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978167873 4:105630705-105630727 AAGCAGGGAGAGAAGGAAAAAGG + Intronic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978385060 4:108169845-108169867 AAGGGGGAAGAGAAGGCAAAAGG + Intergenic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
978586640 4:110281773-110281795 AGCTGGGTATAGAGGGACAACGG + Intergenic
978649572 4:110984361-110984383 AAGAGGGAAGAGAGGAAAAAAGG - Intergenic
978766162 4:112407143-112407165 AACTGGGGAGAGTGGAAAAAGGG + Intronic
978880143 4:113691839-113691861 AAATGGGTGGTGAGGGAAACTGG + Intronic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979973711 4:127169521-127169543 TAGTGGTTGGAGAGGGAAAGAGG - Intergenic
980444368 4:132886547-132886569 AGCTGGGTATAGAGGGACAATGG - Intergenic
980790504 4:137613758-137613780 AGATGGGTAGAGAGGCAAGAAGG - Intergenic
981031129 4:140126914-140126936 TAGTGGGTAGAGATGGAGATAGG - Intronic
981181425 4:141750422-141750444 AAGTCGAAGGAGAGGGAAAAGGG + Intergenic
981186291 4:141807782-141807804 AAGTGGGCATACAGGGAAATGGG - Intergenic
981271326 4:142849501-142849523 ATGTGGGGAGAGAGAGAAAGAGG - Intergenic
982113361 4:152076117-152076139 GATTGGAGAGAGAGGGAAAAGGG + Intergenic
983135170 4:164070114-164070136 AAGTGGGGAGAAAGGGAGAAGGG + Intronic
983552533 4:169032293-169032315 AAGAGGAGAGAGAGGGAATAAGG - Intergenic
983756252 4:171340751-171340773 AAGTAGAAAGAGTGGGAAAATGG - Intergenic
983794106 4:171838483-171838505 AAGGGAGAAGAGAGAGAAAAAGG - Intronic
984911416 4:184676889-184676911 AAGGGGGAAGAGAGGGGAAGGGG - Intronic
985388272 4:189467526-189467548 AAGCAGGTGCAGAGGGAAAATGG + Intergenic
986106800 5:4667494-4667516 AGGTGGGTAGGGTGGGAAAGGGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
987073579 5:14359992-14360014 AGGTGGAGAGAGAGAGAAAAGGG - Intronic
987239634 5:15981903-15981925 AAGGGGGAAGAGAGGGAGAAAGG + Intergenic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988394172 5:30675781-30675803 AAATGGGAAGGGAGGGAAAGTGG + Intergenic
988814741 5:34823517-34823539 AAACTGGTAGAGAGGGAGAAAGG + Exonic
989069846 5:37498722-37498744 ATGTGGGGTGTGAGGGAAAAGGG - Intronic
989512979 5:42309881-42309903 ATGTGGGTAGAGAAGGAGAAAGG + Intergenic
990277691 5:54215617-54215639 AAGGGGGGAGGGGGGGAAAAAGG + Intronic
990754656 5:59055575-59055597 AAGGAGGGAAAGAGGGAAAAAGG - Intronic
990892441 5:60663434-60663456 AGCTGGGTATAGAGGGACAACGG - Intronic
991217616 5:64173640-64173662 AAAAGGGGAGAGAGGGAAAAGGG - Intronic
991618540 5:68520979-68521001 AAAAGGGGAGAGAGGGAGAATGG + Intergenic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
992617106 5:78555524-78555546 ATGTGGGCAGAGGGGGAAAGAGG + Intronic
992766243 5:80003368-80003390 AAGTAGGGAGAGAGAGAAAAAGG + Intronic
993181432 5:84558551-84558573 AAGTAGGTTGAGAGGGAGAGAGG - Intergenic
993335837 5:86657492-86657514 AAGGGAGAAGAGTGGGAAAAAGG - Intergenic
993369899 5:87079840-87079862 AAGTGGGGTGAGAGGAATAAAGG + Intergenic
994032590 5:95161441-95161463 AAGGGGGTCAAGAGGGAAAGGGG + Intronic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994489108 5:100419166-100419188 ATTTGGGTAGACAGGGCAAAGGG + Intergenic
994851997 5:105067534-105067556 GAGCGGGTAGAGGGGGAGAAGGG + Intergenic
994997220 5:107079113-107079135 AAAGGGGGAGAGAGAGAAAAGGG + Intergenic
995116512 5:108486537-108486559 AAGTTATTAGAGAGTGAAAATGG + Intergenic
995391939 5:111649494-111649516 AAGTGGATGGGGAGGAAAAATGG + Intergenic
995408852 5:111832178-111832200 CAGTAGGTACAGAGGAAAAAAGG + Intronic
996187363 5:120493659-120493681 AAGTGGGTATAGCTGTAAAAGGG - Intronic
996343557 5:122465300-122465322 AAGTGGGTGGATAGGGCCAAGGG - Intergenic
996387512 5:122925017-122925039 ATGTGGGGAGAGAAGGAGAAGGG - Intronic
996520004 5:124415592-124415614 AAGTGGACAAAGGGGGAAAACGG + Intergenic
996884745 5:128341701-128341723 AAGTGGGCAGAGAAAGAAATGGG - Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997981182 5:138468087-138468109 AAGGGGAAAGAAAGGGAAAAGGG + Exonic
998015050 5:138725114-138725136 GCCTGGGGAGAGAGGGAAAAGGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998567895 5:143232238-143232260 AAGGGGGGAGAGAGAGAAATGGG + Intergenic
998937085 5:147240836-147240858 AAATGGGAAGAGAGGGAAAAAGG - Intronic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
999371725 5:151059582-151059604 AAGTGGGAAGGAAGGGAGAATGG + Intronic
999785441 5:154885876-154885898 AATAGGGTAGACAGGGAAGAAGG - Intergenic
999882214 5:155878311-155878333 AGAAGGGTAGAGAGGAAAAATGG - Intronic
999952855 5:156668956-156668978 AAGTGGCTGGAGCGGAAAAAAGG + Intronic
1000141504 5:158408708-158408730 AAGTGGGAAAAAAGAGAAAAAGG - Intergenic
1000225846 5:159261323-159261345 AAATGGCCAGAGAGAGAAAAGGG + Intergenic
1000258760 5:159565846-159565868 AGGTAGGTGGAGAGTGAAAATGG - Intergenic
1000365479 5:160486724-160486746 AAGTGGGCAGAGTGTGAGAAGGG - Intergenic
1000419585 5:161023069-161023091 AAGTAGAGAGAGAGGGAATAAGG + Intergenic
1000442090 5:161275985-161276007 AACAGGGTAGACAGAGAAAAGGG + Intergenic
1001043804 5:168355875-168355897 AAGTGGGGAGAGAAGGAGAGAGG + Intronic
1001108374 5:168875146-168875168 AGGAGGGAAGAGAGGGAAAGAGG + Intronic
1001881336 5:175246790-175246812 AAGCGGGCAGGGAGGGAGAAAGG - Intergenic
1002664690 5:180814465-180814487 TGGTGGGTAAAGAGAGAAAAGGG - Intronic
1002959604 6:1901908-1901930 CAGAGGGGAGACAGGGAAAAGGG + Intronic
1003082164 6:3029774-3029796 AAATTAGTAGAGGGGGAAAATGG + Intergenic
1003778489 6:9396615-9396637 GAATGAGTAGAGAAGGAAAAGGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004049418 6:12060859-12060881 AATTAAGTAGGGAGGGAAAATGG + Intronic
1004389554 6:15198604-15198626 GAGTGGCCAGAGAAGGAAAAGGG + Intergenic
1005030937 6:21508485-21508507 AAGCGGATAGAGGGGGAGAAGGG - Intergenic
1005060703 6:21774514-21774536 AAGTGGGGAATGAGGGAGAAAGG - Intergenic
1005109076 6:22258851-22258873 ATGTGGGTAATGAAGGAAAAAGG + Intergenic
1005809683 6:29506345-29506367 ATGGGGGAAGAGATGGAAAAAGG - Intergenic
1006480982 6:34293971-34293993 AAGTGGGGTTAGTGGGAAAAGGG - Intronic
1006486823 6:34349664-34349686 TAGTGGGTGGATAGGGAGAAAGG - Intronic
1007481361 6:42152309-42152331 AGGGGAGTAGAGAGGTAAAATGG + Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1008242752 6:49131683-49131705 AAGTGTGTAGAGGGAGAAATAGG + Intergenic
1008352544 6:50509518-50509540 ACACTGGTAGAGAGGGAAAAGGG - Intergenic
1008527064 6:52417932-52417954 GAGTGGGTAGGGAGGGATCATGG + Intergenic
1008986694 6:57552476-57552498 AAGTTCTTAGAGAGGGGAAAAGG + Intronic
1009174655 6:60445043-60445065 AAGTTCTTAGAGAGGGGAAAAGG + Intergenic
1009544945 6:65009384-65009406 AGCTGGGTATAGAGGGACAATGG - Intronic
1009874825 6:69492980-69493002 AAGTGGGCTGGAAGGGAAAAAGG - Intergenic
1009988926 6:70817019-70817041 AAGTGGGAAGAGATGGAACTGGG - Intronic
1010314398 6:74429358-74429380 AAGTTGGAAGTGAGGGAGAAAGG - Intergenic
1010475074 6:76276694-76276716 AATTGGGAAGTGAGGGGAAAGGG - Intergenic
1010738161 6:79466670-79466692 AAGTTCCTAGAAAGGGAAAAGGG + Intergenic
1011076937 6:83447808-83447830 AGCTGGGTATAGAGGGACAACGG - Intergenic
1011429792 6:87273211-87273233 AAGAGGGTATAGTGGGAATAAGG + Intergenic
1011554870 6:88563796-88563818 GAGTGGGTAGAGGTGGGAAATGG - Intergenic
1011629497 6:89310492-89310514 GAGAGGGTAGAGAGAGAAGATGG - Intronic
1011775705 6:90728194-90728216 AAGTGGGTAGAGAGTGTGAGAGG - Intergenic
1012630106 6:101455362-101455384 AAGTGACTAGAGTGGGAAGAGGG + Intronic
1013215828 6:108026396-108026418 AAGTGGGTGGAGAGTGAAGATGG + Intergenic
1013543705 6:111135473-111135495 AGCTGGGTATAGAGGGACAATGG - Intronic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013663264 6:112320539-112320561 TAGTGGGGAGTGGGGGAAAATGG + Intergenic
1014656156 6:124106994-124107016 AAGTGGGTAGAAAGTGCCAAGGG + Intronic
1014703386 6:124716614-124716636 AAGTGGTTAGAGGGATAAAAGGG - Intronic
1015199490 6:130563358-130563380 AGGTAGGTAGAGAGAGAGAATGG + Intergenic
1015270177 6:131329661-131329683 AAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1015711759 6:136149243-136149265 AAATGGGGAAAGAAGGAAAAAGG - Intronic
1016343092 6:143083539-143083561 AGCTGGGTATAGAGGGACAATGG + Intronic
1016761325 6:147740707-147740729 AACTAGGTATATAGGGAAAAAGG - Intergenic
1017123489 6:151045395-151045417 AAGTGGAGAGAGGGGGAAAAAGG - Intronic
1017240438 6:152162377-152162399 ATGATGGTAGAGAGGGAAAAAGG - Intronic
1017560058 6:155616921-155616943 AGGTGGGGAGAGAGGAAAAGTGG - Intergenic
1017585521 6:155918420-155918442 AAGGGGGAAGAGAGGAAGAAAGG + Intergenic
1018274574 6:162117161-162117183 AAGTGGGAAGGGAGAGAAAGTGG + Intronic
1018278041 6:162153827-162153849 CAGCTGGTAGAGAGGGGAAATGG - Intronic
1018684428 6:166292673-166292695 AAGTAGCTAGAGAGGAACAACGG + Intergenic
1018724532 6:166600792-166600814 AAGTGAATAGAAATGGAAAATGG + Intronic
1018761202 6:166895684-166895706 AGCTGGGTATAGAGGGACAATGG - Intronic
1019151857 6:170011579-170011601 AACTGGGGAGAGAGGCCAAATGG + Intergenic
1019427455 7:984303-984325 GGGTGGGGACAGAGGGAAAATGG - Intronic
1019717067 7:2543974-2543996 ATGGGGGAAGAGAGGGAAAAGGG + Intronic
1019919990 7:4157355-4157377 AAGTGGGAAGGGAGGAAGAAGGG + Intronic
1019964058 7:4484578-4484600 AAGAGAGTGGAGAGGGAAAGGGG + Intergenic
1020433822 7:8140831-8140853 AAGTGGGTGGAAAGGTAAAAAGG + Intronic
1020493076 7:8813280-8813302 AAGAGGGGAGAGAGGGGAATAGG + Intergenic
1020617578 7:10478239-10478261 AAGTGGGAAGAGAAGTAATAAGG + Intergenic
1021012816 7:15492770-15492792 AGGTGGGGAGAAAGAGAAAAAGG + Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021410012 7:20319870-20319892 GAGTGGGTAGAGAAGGAAACTGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1021894229 7:25219164-25219186 AAGGGGGGAGAAAGGAAAAAAGG - Intergenic
1021972370 7:25978084-25978106 AAGTGGGCAGGGAAAGAAAAAGG + Intergenic
1023156392 7:37256577-37256599 AAGGAGGGAGGGAGGGAAAAGGG + Intronic
1023254589 7:38300374-38300396 AACTGGGGAGAGAAAGAAAATGG + Intergenic
1023585310 7:41724023-41724045 AAGAGGGGAGAGAGGGAAAAAGG + Intergenic
1024102405 7:46045607-46045629 AAATTGGTATAGAGTGAAAAAGG - Intergenic
1024236501 7:47402780-47402802 AAGTGGTTAGGGAAGGGAAAAGG + Intronic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1025081551 7:55987796-55987818 AGCTGGGCAGAGAGGGAATACGG + Intronic
1026112094 7:67466432-67466454 AAGGAGGGAGGGAGGGAAAAAGG - Intergenic
1026206013 7:68258117-68258139 GAGTGGGGAGACAGGGAATAAGG + Intergenic
1026441462 7:70448176-70448198 AGGCGGCTAGAGAGGTAAAAAGG - Intronic
1026632398 7:72048769-72048791 AAGGAGGAAGGGAGGGAAAAAGG - Intronic
1026976833 7:74503901-74503923 AAGCAGGGAGAGAGGGGAAAAGG - Intronic
1028074128 7:86490112-86490134 ATGTGGGTTGAAAGGAAAAATGG + Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028462481 7:91111206-91111228 ATTTGGGTAGAGAAGGAAAAAGG - Intronic
1028879625 7:95865418-95865440 AGGAAGGTAGAGAGGAAAAAAGG - Intronic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1030337454 7:108341880-108341902 AGCTGGGTATAGAGGGACAACGG - Intronic
1030635178 7:111940010-111940032 AGGTGGGTAGAGAAGAACAATGG - Intronic
1030653101 7:112136928-112136950 AATTTGGGAGAGAGGCAAAAAGG + Intronic
1030729542 7:112969715-112969737 GAGTGGGGAGAAATGGAAAAAGG - Intergenic
1030740386 7:113102426-113102448 AAGTGGGGAGCAGGGGAAAATGG - Intergenic
1031097418 7:117437152-117437174 AAGTGGGATGATAGGGAAAGGGG + Intergenic
1031131205 7:117835529-117835551 AAGTGACTAGAGAGAGAAAAGGG - Intronic
1031348050 7:120693569-120693591 AAGTGGAGGAAGAGGGAAAAAGG + Intronic
1031820878 7:126499798-126499820 AGGTGGGTGGATGGGGAAAAAGG + Intronic
1031996691 7:128236946-128236968 AAGTGGCTACACAGAGAAAAGGG - Intergenic
1032223687 7:130013182-130013204 AATTAGGAAGAGAGGGAAACAGG - Intergenic
1032424078 7:131806501-131806523 AGTTGGGGAGAGAGGGACAAGGG + Intergenic
1033166346 7:139041688-139041710 AAGTGCATAGAGGGGTAAAAAGG + Intergenic
1033318120 7:140315444-140315466 AAGTGGCAAAAGAGGTAAAACGG + Intronic
1034002399 7:147430166-147430188 TGGTGAGTTGAGAGGGAAAATGG - Intronic
1034934296 7:155188635-155188657 GAGAGGTTAGAGAGGAAAAAGGG - Intergenic
1035080315 7:156210258-156210280 AAGTGGGGGCTGAGGGAAAATGG + Intergenic
1036496624 8:9276053-9276075 AGGTAGGAAGTGAGGGAAAAAGG - Intergenic
1036547065 8:9782163-9782185 AAGTGGAGGGTGAGGGAAAAAGG - Exonic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037004115 8:13755764-13755786 AAATGGGAAAAGAGGAAAAAGGG - Intergenic
1037209354 8:16366890-16366912 AAGAGGGGAGAGTGGGAAGAGGG + Intronic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037334683 8:17780564-17780586 TACTGGGGAGAGAGGGAAAGAGG - Intronic
1037548226 8:19944446-19944468 AAGGGGGGAGAGAGAGAGAAAGG + Intronic
1038217658 8:25577512-25577534 AAGTGGGCACAGAGCGAGAAGGG - Intergenic
1038885432 8:31657943-31657965 ACGTTGGCAGAGAGGGCAAAAGG - Intronic
1039021923 8:33217463-33217485 AAGTGGATAGAGTGGGAAGTTGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1040772872 8:51000206-51000228 AAGTGGGTATGGAGAGATAAAGG - Intergenic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041779145 8:61558335-61558357 AAGTGAGTAGAAAGGGATAGTGG + Intronic
1041796896 8:61754352-61754374 AAGGGGGCAGAGAGGAAAGAGGG - Intergenic
1042839298 8:73107806-73107828 AAGGAGGGAGAGAGGGAAAGAGG - Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1042995378 8:74692466-74692488 AAGGAGGTAGAAAGTGAAAAAGG + Intronic
1043344844 8:79287123-79287145 AAGAGAGAAGAGAGGAAAAAAGG + Intergenic
1043540727 8:81259295-81259317 GAGTAGGTAGAGAGAGGAAATGG + Intergenic
1043978776 8:86614442-86614464 CAGTGGGGAGAGAGAGAGAATGG - Intronic
1044241648 8:89894703-89894725 GAGTAGGTAGAGAGAGAAATAGG + Intergenic
1044324455 8:90844022-90844044 AGGTGGGTAGAAAAGGAAAATGG + Intronic
1044327957 8:90881886-90881908 AAGTTGGTAGAGCTGGACAAAGG + Intronic
1044724290 8:95180373-95180395 CAGTAGCTAGAGAGGGACAAAGG + Intergenic
1045262152 8:100585571-100585593 AAGAGGGAAGAGAGAAAAAAGGG + Intronic
1045381772 8:101634538-101634560 AAGTGGGTAGAAAGAGAAAGGGG + Intronic
1045735551 8:105292532-105292554 AAGTGGATAAAGAAGGAAAGTGG + Intronic
1046234183 8:111400883-111400905 ATGTGGCTAGAGAGGTAAAGTGG + Intergenic
1046548285 8:115679777-115679799 AACTGTGTGGAGAGGCAAAAAGG + Intronic
1046779160 8:118196598-118196620 ATGTGCCTAGAGAAGGAAAAGGG - Intronic
1046825871 8:118690787-118690809 AAGTGGGGAGGGTGGAAAAAGGG - Intergenic
1047182296 8:122600630-122600652 GAATGGGGAGAGAGGGAAATGGG + Intergenic
1047347074 8:124038920-124038942 GAGTGGGTAAAGAAGTAAAAAGG + Intronic
1048350205 8:133609769-133609791 AGGTAGGTAGAGAAGGAACATGG + Intergenic
1048591600 8:135825718-135825740 AAATGGATAAAGAGGGAAAGAGG - Intergenic
1049990735 9:989311-989333 AAGTTGCTGGAGAGGAAAAAAGG - Intronic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050607272 9:7314835-7314857 CAGTGTGTAGAGTGGGGAAAGGG + Intergenic
1050621125 9:7453058-7453080 AAGATGGTTGAGAGGGAAAAGGG - Intergenic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1051169441 9:14304579-14304601 AAGTGGGGAGAGAGAAAAAGGGG + Intronic
1051494252 9:17701104-17701126 GAGAGGGTAGAGAGTGAAAATGG + Intronic
1052002348 9:23300413-23300435 AAGTGGGTTGAGAGGGAGAGAGG - Intergenic
1052316731 9:27123179-27123201 AAGTGGGAAGGGAGGGAGATGGG + Intronic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1053006150 9:34605990-34606012 AGGAGGGAAGTGAGGGAAAAGGG - Intergenic
1053047479 9:34931870-34931892 AAGTGGGAAAAGAGGGCAAGAGG + Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053191802 9:36077569-36077591 AAATGGGTAAAGAGGCAAGATGG + Intronic
1053251243 9:36575575-36575597 AAGCGGGTAGATAGAGAAAATGG + Intronic
1053442230 9:38125966-38125988 AGGTAGGAAGAGAGCGAAAAGGG - Intergenic
1053477701 9:38393959-38393981 AAGTGGAGAGAAAGGGGAAAGGG - Intronic
1053529672 9:38867712-38867734 TGCTGGGTGGAGAGGGAAAAGGG + Intergenic
1053803985 9:41783478-41783500 CAGTGGTTAGAGACAGAAAATGG - Intergenic
1054141295 9:61531979-61532001 CAGTGGTTAGAGACAGAAAATGG + Intergenic
1054192288 9:61994976-61994998 CAGTGGTTAGAGACAGAAAATGG - Intergenic
1054201897 9:62092139-62092161 TGCTGGGTGGAGAGGGAAAAGGG + Intergenic
1054460987 9:65462417-65462439 CAGTGGTTAGAGACAGAAAATGG + Intergenic
1054636460 9:67496220-67496242 TGCTGGGTGGAGAGGGAAAAGGG - Intergenic
1054646118 9:67593715-67593737 CAGTGGTTAGAGACAGAAAATGG + Intergenic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1055873177 9:80910008-80910030 AAGTGTGTAAAGATGAAAAAAGG - Intergenic
1056139601 9:83663093-83663115 AAGAGGGGAAAGAGGAAAAAGGG + Intronic
1056541023 9:87571537-87571559 AAGCAGGCGGAGAGGGAAAAGGG + Intronic
1056634233 9:88318380-88318402 AAGGATGAAGAGAGGGAAAAAGG + Intergenic
1057292914 9:93818610-93818632 AAGAGGGAAGAAAGGGAAAGAGG + Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1057908757 9:99002255-99002277 GAGTTGGGAGAGAGGGACAAAGG - Intronic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058197692 9:101999118-101999140 AAGTGGCCAGAGAGGCAATAAGG + Intergenic
1058980919 9:110169572-110169594 AGGAAGGTAGAGAGAGAAAAAGG + Exonic
1058981359 9:110173619-110173641 AAATGCGGAGAGAGAGAAAAAGG - Intergenic
1059562625 9:115349939-115349961 AAGTGAATAGAGAAGGAAAAAGG + Intronic
1059669336 9:116478109-116478131 GAGGGGGTAGGGAGGGAGAAAGG + Intronic
1059671440 9:116496119-116496141 AAATGGGTTAAGAGGGTAAAGGG - Intronic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1059807803 9:117822833-117822855 AAGAGGTTAGAGAGTGAAGAGGG - Intergenic
1059965443 9:119609367-119609389 AAGAAGGAAGAGAGGGAAAGAGG + Intergenic
1059975814 9:119715762-119715784 AGGTGGGGAGGGAGGGAAAGGGG + Intergenic
1060156297 9:121322132-121322154 AATGGGGTAGAGAGGGACAGGGG - Intronic
1060358045 9:122929254-122929276 AAATGGGCAGAGAGTGGAAACGG + Intronic
1061084371 9:128390572-128390594 AGGTGGGAAGGGAGAGAAAACGG - Exonic
1061231263 9:129317180-129317202 AAGTGTGCAGAGAAGGAACAAGG - Intergenic
1061287673 9:129633375-129633397 AAGGGTGCAGAGAGGGAACATGG - Intronic
1061293492 9:129665494-129665516 AAGTGGGTGGGGAGGGTGAAGGG + Intergenic
1061459489 9:130725235-130725257 AAGTGGGGAAAGAGGGAAATGGG - Intronic
1203608540 Un_KI270748v1:76003-76025 AGGGGGGTGGAGAGGGAGAAAGG + Intergenic
1185569788 X:1124874-1124896 AAGTGGATAGATAGGGAGATAGG + Intergenic
1185668913 X:1790189-1790211 AAGAGGAAAGAAAGGGAAAATGG - Intergenic
1186173633 X:6902894-6902916 AAGTAGGAGGAGGGGGAAAAAGG + Intergenic
1186243460 X:7594346-7594368 AAGTGCCTACAGAAGGAAAAAGG + Intergenic
1186312757 X:8338619-8338641 AAATGGGTAGATATGGAACATGG + Intergenic
1186543385 X:10423957-10423979 AAGTGGGTGGAGTTGGAAGAAGG - Intergenic
1186998930 X:15155233-15155255 AAATGGATAGAGAGAGAGAAAGG + Intergenic
1187389421 X:18876037-18876059 AAAAGGGAAGAGAAGGAAAAGGG - Intergenic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1188772021 X:34163740-34163762 AAGTTGGTAGAGAGGTAATGAGG + Intergenic
1188797657 X:34484779-34484801 AAGTTGGGAGAGAGGTAAAGAGG + Intergenic
1188841825 X:35026168-35026190 AAGTGAATAGAGAGGGTGAAAGG - Intergenic
1188893780 X:35642367-35642389 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
1189117897 X:38362125-38362147 AAGTTGGGAGTGGGGGAAAAGGG + Intronic
1189372380 X:40439031-40439053 AAGTGGAGAGGGAGGGAAAGGGG + Intergenic
1189447243 X:41092205-41092227 AATTGGGTGGAAAGGAAAAAGGG + Intronic
1189529288 X:41862626-41862648 AAGTGGCTGGAAAAGGAAAAGGG + Intronic
1189685451 X:43559541-43559563 AAGTTGGTGGAGAGGCAAAGAGG + Intergenic
1189724443 X:43954435-43954457 AAATGGGGAGAGAGGGAGGAGGG - Intronic
1189734602 X:44056999-44057021 GAATGGGTAGAGAGAGAGAAAGG - Intergenic
1190123047 X:47679306-47679328 AATTGGGTATAGAGGGATGAGGG + Intergenic
1190332589 X:49245038-49245060 AAGTGGACAGAGAGGAAAAGGGG - Intronic
1190456935 X:50635790-50635812 AAGGGGGAAGAAAGGGAAACAGG + Intronic
1190512581 X:51188809-51188831 GAGAGGGTGGAGAGGGAAAGGGG + Intergenic
1190730217 X:53220919-53220941 GAGAGGGTAGAGAGGGGAAAGGG + Intronic
1192207814 X:69107702-69107724 AAGAAGGAAGGGAGGGAAAAGGG - Intergenic
1192238372 X:69310695-69310717 AAGTGGGTAGAGAGGTACCAGGG + Intergenic
1192264322 X:69528851-69528873 CAGGGGGTAGAGAGGAAGAAGGG - Intronic
1193237314 X:79123648-79123670 AAATGGGAAGAAAGGGAAAGGGG + Intergenic
1194305733 X:92245811-92245833 AAGTGAGTAGAGACCTAAAATGG + Intronic
1194649831 X:96501304-96501326 GAGTGGGGAGAGAGGGAATGAGG - Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1195141562 X:101965508-101965530 GAGTTGGGAGAGGGGGAAAATGG - Intergenic
1195374910 X:104217542-104217564 GAGAGGGGAGAGAGAGAAAATGG - Intergenic
1195522308 X:105845395-105845417 AAGTGGGGAAAGAGAGAAATAGG + Intronic
1195535108 X:106001531-106001553 AGCTGGGTATAGAGGGACAATGG - Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195611310 X:106870461-106870483 ATGTGGCGAGAGAGGGAGAAAGG - Intronic
1195970019 X:110462884-110462906 AAGAGGGAAGAGAGGGAAAGTGG + Intergenic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197241965 X:124129642-124129664 AAGATGGCAGAGAGGGAAAGAGG - Intronic
1197634916 X:128904059-128904081 GAGTGGGTAGAGAGGGGATCTGG - Intergenic
1197802417 X:130365489-130365511 AAGTGGGCAGGGAGTGAAAGTGG + Intronic
1197926061 X:131647696-131647718 CACTGTGCAGAGAGGGAAAAGGG - Intergenic
1198229201 X:134673381-134673403 GAGAGGGGAGACAGGGAAAAGGG + Intronic
1198649464 X:138845835-138845857 AAGTAAGTACAGAGGGGAAATGG + Intronic
1199288368 X:146078563-146078585 GAGTGGGTAGGGAGAGAATAGGG + Intergenic
1199316580 X:146385562-146385584 GAGTGGGGAGAGAGAGAAAAGGG + Intergenic
1199402834 X:147419924-147419946 AAGAGGGGAGAGAGAGAAAAGGG + Intergenic
1199405805 X:147458191-147458213 AAGAGGGGAGACAGGGAGAAGGG + Intergenic
1199692112 X:150316637-150316659 TAAGGGGTTGAGAGGGAAAAGGG - Intergenic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic