ID: 1077363252

View in Genome Browser
Species Human (GRCh38)
Location 11:2150426-2150448
Sequence TCAAATCTGGCATGTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077363252 Original CRISPR TCAAATCTGGCATGTGTTGG GGG Intronic
902273880 1:15325653-15325675 TCAAATCAGGTATGTGTTAGGGG - Intronic
905142387 1:35858372-35858394 TCTAATTTGGCATGAGATGGAGG + Intergenic
906153593 1:43601563-43601585 TCACATCTGGGATGCTTTGGCGG + Intronic
906584349 1:46963359-46963381 TACAATCTGGCATGTTTTTGCGG + Intergenic
906689363 1:47782504-47782526 TCAAGTCTGGCATGTGGCAGTGG + Intronic
908246742 1:62233355-62233377 TGAAATGTGACAAGTGTTGGAGG - Intergenic
912872552 1:113322958-113322980 ATAAAACTGGCATGAGTTGGGGG - Intergenic
913295747 1:117318448-117318470 TAAAATGTGTCATATGTTGGAGG + Intergenic
913666641 1:121054935-121054957 ACAAATCTGGCATGCAATGGTGG + Intergenic
914018325 1:143842059-143842081 ACAAATCTGGCATGCAATGGTGG + Intergenic
914656940 1:149750576-149750598 ACAAATCTGGCATGCAATGGTGG + Intergenic
915430105 1:155859914-155859936 TAAAATCGGGCCTGTGGTGGTGG + Intronic
916045582 1:160997781-160997803 TGAAATTGGGCGTGTGTTGGAGG - Exonic
923557932 1:235015765-235015787 TCAGAGCTGGGATCTGTTGGTGG - Intergenic
923809217 1:237293924-237293946 TCAAGGGTGGAATGTGTTGGGGG + Intronic
1063932179 10:11039866-11039888 TGGAATGTGGTATGTGTTGGGGG + Intronic
1066684670 10:37969118-37969140 TTAAAAATGGCAGGTGTTGGGGG + Intronic
1067194692 10:44106685-44106707 TTAAATCTGGCATGAGATAGGGG - Intergenic
1068091074 10:52432824-52432846 TCTAATCTAACATGTGGTGGGGG - Intergenic
1070463936 10:76699549-76699571 TCAAATGTGACATATGTTGCAGG + Intergenic
1073007219 10:100333831-100333853 ACAAACCTGGCATGTGGTTGAGG + Intergenic
1073420123 10:103417989-103418011 TCCAATATGCCATGTGTTAGTGG - Intronic
1077363252 11:2150426-2150448 TCAAATCTGGCATGTGTTGGGGG + Intronic
1078091346 11:8266470-8266492 TCACCTGTGGAATGTGTTGGGGG - Intronic
1082798318 11:57394786-57394808 TTTAAGCTGTCATGTGTTGGGGG - Intronic
1083841836 11:65309106-65309128 TCCAATCTGGCCAGTGTTGCCGG + Intergenic
1085816536 11:79743038-79743060 TCAGAACAGGCATGTGTTTGGGG - Intergenic
1087095323 11:94312430-94312452 TCAGAGTTGGCAGGTGTTGGGGG - Intergenic
1087551717 11:99659019-99659041 TCAACTGTGGCAGGGGTTGGAGG - Intronic
1088986114 11:114909985-114910007 TCAAAACTGCTAGGTGTTGGTGG - Intergenic
1088991346 11:114956234-114956256 TTAAATCTGGCAGGGGGTGGAGG - Intergenic
1090791734 11:130096030-130096052 TAAAACCTGGAATGGGTTGGAGG + Intronic
1091003553 11:131931737-131931759 TGTAATCTGGCATGTGGTGGGGG + Intronic
1091331383 11:134733773-134733795 GCACATCTGGCATGTCGTGGTGG + Intergenic
1095917244 12:47492251-47492273 TCAACTCTGGCACCTGATGGTGG + Intergenic
1096442217 12:51652924-51652946 TCATTTATGGCATATGTTGGGGG + Intronic
1103011181 12:117459694-117459716 TCAAATCTGCTGTGTGTTGGTGG - Exonic
1103435708 12:120923815-120923837 ACAGATCTGACATGTGCTGGAGG - Intergenic
1105804061 13:23939364-23939386 TCAAATCTAGAATGACTTGGTGG - Intergenic
1109763992 13:66869311-66869333 TCAAAACTGGCATTTCTTGAAGG + Intronic
1109848889 13:68034893-68034915 TTAATGCTGGAATGTGTTGGGGG - Intergenic
1113011118 13:105767079-105767101 TCAAATGTGTCATGTTTTGAAGG + Intergenic
1117117309 14:52527266-52527288 TCAGATCCTGCATGTGTTGAAGG - Intronic
1129537752 15:76327959-76327981 TCAAATGTGGCCTGTGTAGGAGG - Intergenic
1129822898 15:78616791-78616813 TCAAAGCAGGCATGGGTGGGTGG - Intronic
1131349035 15:91679612-91679634 CCAAGTCTGACATGTGTGGGTGG + Intergenic
1131743334 15:95418231-95418253 TCTAATCTGGCAAGACTTGGAGG - Intergenic
1135716551 16:24774784-24774806 TGAATTCTGGTATCTGTTGGGGG - Intronic
1138528327 16:57621283-57621305 GCATTTCTGGGATGTGTTGGGGG + Intronic
1141559769 16:84859575-84859597 TCAAATCTGGAAATTGATGGAGG + Intronic
1143359778 17:6359487-6359509 TGCACTCTGGCATGGGTTGGAGG + Intergenic
1144281954 17:13735109-13735131 TCAAACCTAGCATTTGTGGGGGG + Intergenic
1148320214 17:46744383-46744405 TCAAAACTGCTATGTGCTGGGGG - Intronic
1152735266 17:81994138-81994160 GCACATCAGGCATGTGTGGGAGG + Intronic
1153045041 18:848207-848229 TCCACTCTGGCCAGTGTTGGAGG + Intergenic
1153955158 18:10089884-10089906 TCTAATGTGGCAGTTGTTGGGGG - Intergenic
1154069383 18:11139771-11139793 TCAAATCTGGGAAGTGATTGAGG + Intronic
1154417180 18:14184906-14184928 TCAAACCTAGAATGTCTTGGTGG + Intergenic
1155989508 18:32265322-32265344 TAAAACTTGGAATGTGTTGGAGG - Intronic
1157174854 18:45442032-45442054 TCATATCTGGCTTGTTGTGGAGG + Intronic
1158647332 18:59258666-59258688 TAAAATTTGGCATGTTTTTGCGG - Intergenic
1158869538 18:61671473-61671495 TCAAATATGGCATGTTTTGAAGG - Intergenic
1158982136 18:62773537-62773559 AAAAATCTGGCATGTTTTGGAGG - Intronic
1160261735 18:77300671-77300693 TCACATCTGTCATGTGCAGGTGG - Intergenic
1160570263 18:79812064-79812086 CCAAATCTGGGAGGTTTTGGGGG - Intergenic
1161331730 19:3691833-3691855 TCATTTCTCGCTTGTGTTGGGGG - Intronic
1162326728 19:10003901-10003923 TCATGCCTGGGATGTGTTGGAGG + Intronic
1162894900 19:13759339-13759361 TCAAAGCTAGGATGTGGTGGGGG - Intronic
1164447711 19:28331952-28331974 TTTCAGCTGGCATGTGTTGGAGG - Intergenic
1167640130 19:50676873-50676895 TTACATCTGGGATGTCTTGGAGG + Intronic
1168199438 19:54804245-54804267 TCAAAGCTGGGGTGTGTGGGGGG + Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926043739 2:9694570-9694592 TCAAATTTGGTATGTGTGGCCGG - Intergenic
926412917 2:12623450-12623472 TCAAATCTGGCGTGGTTTAGTGG - Intergenic
927265124 2:21138067-21138089 ATAAATCTGGCATTTGTTGAGGG - Exonic
927691120 2:25209006-25209028 TCAAATCTGTGCTGGGTTGGTGG - Intergenic
929266320 2:39922440-39922462 TCAAATTTTGCTTGTGTTTGGGG + Intergenic
929410808 2:41696061-41696083 TCAGATCAGGCAGGTGTTGGAGG - Intergenic
930568378 2:53052390-53052412 TCTAATCTGAAATGTGTTGTTGG - Intergenic
931254125 2:60555325-60555347 CCAAATCTGGAAGGAGTTGGGGG + Intergenic
934500068 2:94852375-94852397 TCAAATCTAGAATGTCTTAGTGG - Intergenic
936053673 2:109244480-109244502 TCACATTTGGCATTTGTTTGGGG - Intronic
936074207 2:109391366-109391388 GCACATCTGCCATGTGCTGGAGG + Intronic
936664079 2:114574588-114574610 TCAAATGTGACAGGTGCTGGGGG - Intronic
943827930 2:192419540-192419562 TCTACTCAGGCATTTGTTGGAGG + Intergenic
945190202 2:207180028-207180050 TCAAATCTGATTAGTGTTGGAGG + Intergenic
1169497514 20:6129466-6129488 CCAAATCTGGCATCTGTTAGCGG - Intergenic
1171891287 20:30719152-30719174 TCAAACCTAGAATGTCTTGGTGG - Intergenic
1175962842 20:62645832-62645854 TCTAATCTGGCAAGCCTTGGGGG + Intronic
1176856147 21:13974356-13974378 TCAAACCTAGAATGTCTTGGTGG - Intergenic
1177770205 21:25505458-25505480 GCAAATGTGGCAGGTGTTGAGGG - Intergenic
1179819270 21:43927093-43927115 TCAAATCTGGTATTGGCTGGTGG - Intronic
1179903190 21:44405740-44405762 TCAAAGCTGGCATGAGATTGAGG - Intronic
1180845058 22:18976319-18976341 TGACATCTGGCATGTGGCGGTGG - Intergenic
1182806005 22:33070993-33071015 TTATTTCTGGCATGTGTTGAAGG - Intergenic
1184589691 22:45473630-45473652 TAAAATCTGGCAAGTGTCTGGGG + Intergenic
951207628 3:19941271-19941293 TCAAATAGGGCATGTGTAAGAGG + Intronic
951602900 3:24396487-24396509 TGAAAACTGGCAAGAGTTGGAGG - Intronic
953598720 3:44342758-44342780 TCAAATCAGTAATATGTTGGGGG + Intronic
956107516 3:65836252-65836274 TCAGATCTTGCATGTGTTCATGG - Intronic
958918799 3:100079742-100079764 TCAAATCTGGGATTTGCTGTGGG - Intronic
959034356 3:101343290-101343312 TTAAATTTAGCATCTGTTGGTGG + Intronic
960527193 3:118723359-118723381 TCAAATAGGTCATGTTTTGGTGG - Intergenic
967471679 3:189869174-189869196 TCTAATCTTACATGTGTTGCTGG + Intronic
968352863 3:198075931-198075953 TCAAATCTAGAATGTCTTGGTGG - Intergenic
969553862 4:7892823-7892845 TCAAACGTGGGATGTGGTGGGGG + Intronic
969606277 4:8203851-8203873 GCAAATCAGGCAGCTGTTGGGGG - Intronic
971260632 4:25053691-25053713 TCAAGTCTGCCATGTGTTTCTGG - Intergenic
975774357 4:77768175-77768197 TCAAATCTGGCAGGGCGTGGTGG + Intronic
976431928 4:84972199-84972221 TCACAACTAGCATGTGGTGGTGG + Intergenic
978026854 4:103887071-103887093 TAAAATATTGCATGTATTGGAGG - Intergenic
983186117 4:164702297-164702319 TCAAATTTGTCATGTTCTGGAGG + Intergenic
983794677 4:171846500-171846522 TCAATTGTAGCATCTGTTGGTGG + Intronic
983946474 4:173591468-173591490 TCATATCTGGCTGGTGGTGGTGG + Intergenic
986418714 5:7554694-7554716 TCAAATCTGCCTTGTTTTGCAGG + Intronic
987875469 5:23675308-23675330 TGCAATGTGGCATGTGTTGGGGG - Intergenic
987937330 5:24482860-24482882 GCAAGTTTGGCATGTATTGGTGG + Intergenic
988237290 5:28561784-28561806 TCAAGTGTGGCATGTGTAGATGG - Intergenic
994131355 5:96232014-96232036 GAAAATATGGTATGTGTTGGTGG + Intergenic
998392257 5:141794964-141794986 TAAATTCTGCCATGTGTTGCTGG - Intergenic
998747772 5:145280895-145280917 CCAAAACTGGCTTGTGATGGCGG + Intergenic
1000257865 5:159558036-159558058 TAAAATCTGGGATGCCTTGGAGG + Intergenic
1002812184 6:641204-641226 TCTAATCTGCCATTTCTTGGTGG - Intronic
1003295768 6:4826023-4826045 TCAACTCTGGCACCTGTTAGTGG + Intronic
1004302870 6:14474586-14474608 TCTCATCTGGCATGAGGTGGGGG + Intergenic
1005230277 6:23693237-23693259 TCAAAACTGTCCTGTGTTGCGGG - Intergenic
1009949193 6:70376015-70376037 TCCAATCGCGTATGTGTTGGGGG - Intergenic
1012358027 6:98340572-98340594 TCAAATCTGTCATCTGTCGAGGG - Intergenic
1013349310 6:109291032-109291054 ACTAATCTGAAATGTGTTGGTGG + Intergenic
1016198702 6:141379767-141379789 TTAAATTTGGCATCTGTAGGGGG + Intergenic
1017033029 6:150241029-150241051 TCTAATGAGGCATGTCTTGGTGG + Intronic
1024588812 7:50863536-50863558 TCTACACTGGCATGTGTTGATGG + Intergenic
1031438010 7:121756730-121756752 TCAAACCTGTGATGTGCTGGAGG - Intergenic
1033918319 7:146355764-146355786 TTAAATTTTGGATGTGTTGGTGG + Intronic
1037460290 8:19101769-19101791 GAAAATCTAGAATGTGTTGGAGG - Intergenic
1038025464 8:23584894-23584916 TCAAATCTGCCATATCTTTGAGG - Intergenic
1038432639 8:27512327-27512349 ACACAGCTGGCCTGTGTTGGAGG + Intronic
1040082233 8:43298317-43298339 TCAAATCTAGAATGTCTTGATGG + Intergenic
1046451924 8:114404290-114404312 TCAAATCTGGCAGTTGTTTTGGG - Intergenic
1048150126 8:131885859-131885881 TCAACTCTGGCTTGTGAAGGAGG - Intergenic
1048521060 8:135155713-135155735 TATAATTTGGCATGTTTTGGGGG + Intergenic
1050387842 9:5110038-5110060 TTGAATCTCTCATGTGTTGGAGG - Intronic
1050738731 9:8794635-8794657 TCAAATTTGGCTTCTGCTGGGGG - Intronic
1053657105 9:40228161-40228183 TCAAATCTAGAATGTCTTAGTGG + Intronic
1053907467 9:42857456-42857478 TCAAATCTAGAATGTCTTAGTGG + Intergenic
1054357554 9:64076656-64076678 TCAAACCTAGAATGTCTTGGTGG + Intergenic
1054369222 9:64374441-64374463 TCAAATCTAGAATGTCTTAGTGG + Intronic
1054527493 9:66148064-66148086 TCAAATCTAGAATGTCTTAGTGG - Intronic
1054676853 9:67864189-67864211 TCAAATCTAGAATGTCTTAGTGG + Intronic
1057153311 9:92814903-92814925 TCAAATCTAGAATGTCTTGGTGG + Intergenic
1057627392 9:96689620-96689642 TCAAATCTGTCATGTGTTGAAGG - Intergenic
1057682614 9:97204057-97204079 TCAAATCTAGAATATCTTGGTGG - Intergenic
1059592156 9:115673240-115673262 TCAAAGTTGACATGTGGTGGTGG + Intergenic
1203560899 Un_KI270744v1:56847-56869 TCAAACCTAGAATGTCTTGGTGG - Intergenic
1186168261 X:6849967-6849989 TCAAAGCAGGAAAGTGTTGGAGG + Intergenic
1187524355 X:20040465-20040487 TCAAATCTGACATGGGCTGAAGG - Intronic
1190975001 X:55390100-55390122 TGTACACTGGCATGTGTTGGTGG - Intergenic
1192066197 X:67888058-67888080 TACAATTTGGCATGTGTTTGCGG + Intergenic
1195056043 X:101145918-101145940 TCAAATCTTTCATTTTTTGGGGG - Intronic
1196202822 X:112905327-112905349 TCAAAGCTGGCTTGTATTAGTGG + Intergenic
1196725380 X:118890508-118890530 TCAAATCTGTCTGGTTTTGGTGG - Intergenic
1197394582 X:125910912-125910934 TCAAATTTGGCATCTGGTGAGGG + Intergenic
1197486204 X:127054910-127054932 TCCAATTTGGCATGTTTTTGCGG + Intergenic
1198503711 X:137280377-137280399 TAAAATAGGGTATGTGTTGGGGG + Intergenic
1198734458 X:139771103-139771125 CCAAAACTGCCATGTGTTGTGGG + Intronic
1199420714 X:147641289-147641311 CCAAATATGGCATGGGTTGAGGG + Intergenic
1199465409 X:148129966-148129988 TCAAATCTGTCAGGTTTTGAAGG - Intergenic
1199834517 X:151575307-151575329 TCTAATCTGGAAAGTCTTGGTGG + Intronic