ID: 1077363646

View in Genome Browser
Species Human (GRCh38)
Location 11:2152445-2152467
Sequence TGCTTGGAGGACGGATGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077363641_1077363646 -8 Left 1077363641 11:2152430-2152452 CCACTCGCACATCAGTGCTTGGA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1077363646 11:2152445-2152467 TGCTTGGAGGACGGATGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 211
1077363639_1077363646 0 Left 1077363639 11:2152422-2152444 CCACTGTGCCACTCGCACATCAG 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1077363646 11:2152445-2152467 TGCTTGGAGGACGGATGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 211
1077363638_1077363646 9 Left 1077363638 11:2152413-2152435 CCAAGGGGACCACTGTGCCACTC 0: 1
1: 0
2: 1
3: 14
4: 139
Right 1077363646 11:2152445-2152467 TGCTTGGAGGACGGATGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 211
1077363633_1077363646 27 Left 1077363633 11:2152395-2152417 CCCGAGGGGCTGGCAGGGCCAAG 0: 1
1: 0
2: 5
3: 59
4: 421
Right 1077363646 11:2152445-2152467 TGCTTGGAGGACGGATGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 211
1077363634_1077363646 26 Left 1077363634 11:2152396-2152418 CCGAGGGGCTGGCAGGGCCAAGG 0: 1
1: 0
2: 8
3: 66
4: 501
Right 1077363646 11:2152445-2152467 TGCTTGGAGGACGGATGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077363646 Original CRISPR TGCTTGGAGGACGGATGGGC AGG Intronic