ID: 1077364875

View in Genome Browser
Species Human (GRCh38)
Location 11:2157589-2157611
Sequence CACCCAAGGTGGTGCCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077364860_1077364875 29 Left 1077364860 11:2157537-2157559 CCTGGGGGCTCCGGGAGCATGCA 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG 0: 1
1: 0
2: 0
3: 11
4: 121
1077364869_1077364875 0 Left 1077364869 11:2157566-2157588 CCGCCAGGGCATCTGGGGACCGG 0: 1
1: 0
2: 1
3: 17
4: 171
Right 1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG 0: 1
1: 0
2: 0
3: 11
4: 121
1077364868_1077364875 1 Left 1077364868 11:2157565-2157587 CCCGCCAGGGCATCTGGGGACCG 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG 0: 1
1: 0
2: 0
3: 11
4: 121
1077364867_1077364875 2 Left 1077364867 11:2157564-2157586 CCCCGCCAGGGCATCTGGGGACC 0: 1
1: 0
2: 1
3: 12
4: 159
Right 1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG 0: 1
1: 0
2: 0
3: 11
4: 121
1077364861_1077364875 19 Left 1077364861 11:2157547-2157569 CCGGGAGCATGCACACTCCCCGC 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG 0: 1
1: 0
2: 0
3: 11
4: 121
1077364871_1077364875 -3 Left 1077364871 11:2157569-2157591 CCAGGGCATCTGGGGACCGGCAC 0: 1
1: 0
2: 5
3: 16
4: 126
Right 1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG 0: 1
1: 0
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077364875 Original CRISPR CACCCAAGGTGGTGCCTGAC AGG Intronic
902329702 1:15725267-15725289 GACCCCGGGGGGTGCCTGACAGG + Intronic
903056445 1:20639486-20639508 CACCCAGGGTGGAGCATGTCAGG + Intronic
903351336 1:22718329-22718351 CAGGGAAGGTGGTGCCTGGCAGG - Intronic
905441760 1:38000504-38000526 CACCCAAGATGGGGCCTGATTGG - Intronic
905838661 1:41153668-41153690 CACCCACTGTGATGGCTGACTGG + Intronic
914378549 1:147095138-147095160 CAGCCAAGGTGGTGCCTTTCTGG - Intergenic
918520829 1:185413020-185413042 CAACCAAGGTGTGGCCTGGCTGG + Intergenic
919820179 1:201467750-201467772 CTCCCAAGGTGGGGCCTCAGTGG - Intronic
920323381 1:205141988-205142010 GGCCCATGGTGGTGCCTGTCAGG + Intergenic
921186779 1:212677381-212677403 CAAACAAGGTGGTGCCTGTGGGG + Intergenic
924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG + Intergenic
1067910727 10:50344070-50344092 CACCCAAGAAGGTGGCAGACTGG - Exonic
1069757411 10:70781786-70781808 CATCCAAGGTAGGGCCTGGCTGG - Exonic
1070524480 10:77283434-77283456 TAACCAAGATGGTGCCTGTCAGG + Intronic
1072546067 10:96440275-96440297 CACCCTGCATGGTGCCTGACTGG + Intronic
1072674026 10:97452277-97452299 CACCCCAGGTGGGTCCTCACAGG + Exonic
1077362843 11:2148321-2148343 CACCCAGGGTGGTGTCTGTGGGG - Intronic
1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG + Intronic
1077417719 11:2432626-2432648 CACCCAAGGATGTGCCTGGGGGG - Intergenic
1080356682 11:31455892-31455914 CAGTTAAAGTGGTGCCTGACAGG + Intronic
1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG + Intronic
1082676592 11:56112533-56112555 TACCCTAGCTGGTGTCTGACTGG - Intergenic
1083910662 11:65707340-65707362 CAGGCATGGTGGTGCATGACTGG + Intergenic
1084379966 11:68805570-68805592 CCCCCACAGTGGTGCCTGCCTGG - Intronic
1087974338 11:104525754-104525776 CACCCAATGTAGTGCCTGGCAGG + Intergenic
1096196828 12:49654014-49654036 CCCCCATGGAGCTGCCTGACTGG + Intronic
1100161697 12:91867997-91868019 CAGGCAAGGTGGTGCATGCCAGG + Intergenic
1104629591 12:130388253-130388275 CAGGCAAGGTGGTGCATGCCTGG - Intergenic
1104733152 12:131120118-131120140 CACCCAATGTGGTGTCTCCCCGG - Intronic
1106483810 13:30155701-30155723 CATCCAAGGTGGTGCCCGGGTGG + Intergenic
1108688796 13:52845191-52845213 CACCCATGCTGCTGCCTAACAGG + Intronic
1111869885 13:93818461-93818483 CACCCTAGGTGGGCCGTGACTGG + Intronic
1112567932 13:100567159-100567181 CACTTAAGGTGGTGACTGCCAGG + Intronic
1119687061 14:76641450-76641472 GTGCCAAGGTGGAGCCTGACAGG + Intergenic
1122709865 14:103648391-103648413 GTCCCAATGTGGAGCCTGACAGG + Intronic
1125724145 15:41859695-41859717 CACCTTAGGTGGTTCCTGGCAGG - Intronic
1126929793 15:53634806-53634828 CAACCAAGGTGGTGCCAGTAGGG + Intronic
1129189429 15:73928498-73928520 CACCCAGGCCAGTGCCTGACTGG - Intronic
1130568759 15:85021950-85021972 CACTTAAGGTGGTGCCTGCCAGG + Intronic
1134836454 16:17365275-17365297 CAACCAAGGTGTTGCATAACGGG + Intronic
1136686623 16:31998641-31998663 CACTCACGGTGGTGCCTGGCAGG + Intergenic
1136787235 16:32942178-32942200 CACTCACGGCGGTGCCTGGCAGG + Intergenic
1136845404 16:33572505-33572527 CACCCAAGGTGAGGCCTTTCAGG + Intergenic
1136882540 16:33911606-33911628 CACTCACGGTGGTGCCTGGCAGG - Intergenic
1138952261 16:61927666-61927688 CACCTGATGGGGTGCCTGACGGG - Intronic
1140958604 16:79891127-79891149 CACCCAGGGTGGTTCCTAGCTGG - Intergenic
1203089471 16_KI270728v1_random:1203850-1203872 CACTCACGGCGGTGCCTGGCAGG + Intergenic
1203107112 16_KI270728v1_random:1421158-1421180 CACCCAAGGTGAGGCCTTTCAGG + Intergenic
1143130064 17:4672399-4672421 CACCCCAGTTGGTCCCTGAAGGG - Exonic
1144865513 17:18332969-18332991 CACCCAAGGGGGCGGCTGGCTGG + Intronic
1146183627 17:30711451-30711473 CCCCAAAGCTGGGGCCTGACAGG - Intergenic
1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG + Intronic
1150550288 17:66203758-66203780 CACCCCAGCTGGTGTCTCACAGG - Intergenic
1156291836 18:35754577-35754599 TCCCCAAGGTGGTTCCTGAGGGG + Intergenic
1159100122 18:63949256-63949278 CCCGCTAGGTGGTGCCTGGCTGG + Intergenic
1160299533 18:77667615-77667637 CACCCAAGGAGGGTCCTGCCAGG - Intergenic
1160622062 18:80178648-80178670 CACCCCAGATGGTTCCTGCCAGG + Intronic
1161645643 19:5451674-5451696 CAGCCAAGGTGGGGGCTGGCGGG + Intergenic
1162753188 19:12841154-12841176 CACCCGAGCTGGGGCCTGAGGGG + Intronic
1162975172 19:14204301-14204323 CCCCAAAGCTGGGGCCTGACAGG + Intronic
1164474257 19:28563058-28563080 CAGCCAAGGTAGTGCCTGCTGGG + Intergenic
1164593468 19:29518916-29518938 CACCCCAGGTGCTGACTGACTGG + Intergenic
1166720066 19:44991457-44991479 CACCCTAGGTTGTCCCTGTCTGG - Intronic
1167745391 19:51347817-51347839 CACCCAAGCTGGTGCTTCACTGG - Intronic
1168048476 19:53810957-53810979 CACACAAGGTGATGCTGGACTGG - Exonic
1168354931 19:55695028-55695050 CACCAGAGGAGGTGCCTCACGGG + Intronic
926141615 2:10371482-10371504 CAGCCAAGGTGGGGCCACACTGG - Intronic
929935116 2:46288951-46288973 CACCTAAGTTAGTGCCTGATAGG - Intergenic
932413039 2:71558487-71558509 CACCCAAGGTGGTGCCAACATGG - Intronic
935078119 2:99766029-99766051 TACCCAAGCTGGTGCCTGCAAGG - Intronic
937249132 2:120512275-120512297 CACCCAAGCTGGGGTCTGAATGG - Intergenic
1171958239 20:31475675-31475697 CACCTAACCTGGGGCCTGACCGG + Intronic
1173306336 20:41854002-41854024 CAGCCAAGTTGGTGCTGGACAGG - Intergenic
1175280837 20:57803271-57803293 CCCCCAGGGTGGTGTCTGATGGG - Intergenic
1175714312 20:61245501-61245523 AACCCAAGGTGGCCCCTTACTGG + Intergenic
1176185860 20:63778582-63778604 CACCCCGTGTGCTGCCTGACGGG - Intronic
1176205906 20:63888011-63888033 GAATCAGGGTGGTGCCTGACAGG - Intronic
1176382039 21:6118444-6118466 CCTCCAAGCCGGTGCCTGACAGG - Intronic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1179741433 21:43419795-43419817 CCTCCAAGCCGGTGCCTGACAGG + Intronic
1180130452 21:45823604-45823626 CACCCAAAGGGGTGGCCGACGGG + Intronic
1180945726 22:19692072-19692094 CGCCCAAGGTGGGGCCTGGTGGG + Intergenic
949514640 3:4796005-4796027 CACATAAGGTGGTTCCTGGCAGG - Intronic
952392753 3:32894564-32894586 TACCCAAAATGGTGCATGACTGG + Exonic
952772549 3:37015687-37015709 CACTGTAGGTGCTGCCTGACTGG + Intronic
952929133 3:38346409-38346431 CACCCATGGTGGTGACTCAGGGG - Intergenic
954139559 3:48597874-48597896 CACCCAGGGTTGGGCCTGTCAGG + Intergenic
954320909 3:49831470-49831492 CACCCAAGGGGGTGACCCACAGG - Intronic
955360604 3:58270970-58270992 CACCCATGGAGGTGCCTACCAGG - Exonic
963917940 3:150877208-150877230 AAACCAACGTGCTGCCTGACAGG - Intronic
970301071 4:14681760-14681782 CACCAAGGGTGGTTCCTGACTGG + Intergenic
972281595 4:37606911-37606933 TGCCCAAGGTGGTGTCTGCCAGG - Intronic
974627883 4:64447013-64447035 TATCCAAGTGGGTGCCTGACAGG - Intergenic
983657892 4:170101346-170101368 CACCCCAGCTGGTGTCTCACTGG - Intergenic
985472994 5:57729-57751 CAAGGAAGGTGGTGCCTGCCAGG + Intergenic
993115513 5:83715540-83715562 CACCTAGCGTGGTGCCTGCCTGG + Intronic
996653666 5:125913684-125913706 CACCCCAGCTGGTGTCTCACTGG + Intergenic
997622206 5:135306253-135306275 GATCCAAGGTGGTGCATGCCAGG - Intronic
1000172027 5:158712018-158712040 CACCCAGGGGAGTGCCTTACAGG + Intronic
1006503299 6:34471922-34471944 CACCTAAAGTGGTGCCTGGCAGG - Intronic
1008081934 6:47204108-47204130 ACCCCAAGGTAGTGCCTGAGTGG - Intergenic
1010018684 6:71135098-71135120 CACCCCAGATGGTGTCTCACTGG - Intergenic
1011335947 6:86259799-86259821 CTCCCAGGCTGCTGCCTGACTGG + Intergenic
1019839561 7:3426637-3426659 GACCAAAGGTGGTGACTAACTGG - Intronic
1020661670 7:10991431-10991453 CACCCAAGGTGTTGGATTACAGG + Intronic
1020683019 7:11259923-11259945 CAGCCAAGGAGGGGCCAGACTGG - Intergenic
1023839271 7:44086954-44086976 CACCCAAGCTGCTGCATTACCGG - Intergenic
1027024773 7:74843181-74843203 CTCCCAAAGTGGTGGGTGACAGG + Intronic
1027062991 7:75100938-75100960 CTCCCAAAGTGGTGGGTGACAGG - Intronic
1031141296 7:117946443-117946465 CTCCCAAGGTGAGGCCTGAATGG - Intergenic
1034453371 7:151149807-151149829 CACTCAAGGTGCTGCATGGCTGG - Intronic
1035016071 7:155767305-155767327 CACCACAGGTGGCACCTGACGGG - Intronic
1035238818 7:157517176-157517198 CACCCAGGGTGCTGCCAGTCTGG + Intergenic
1036001358 8:4608342-4608364 TAGCCACGGTGGTGGCTGACCGG + Intronic
1038628590 8:29218841-29218863 CAGCCAAGGGAGAGCCTGACAGG + Intronic
1039469590 8:37804976-37804998 TACCCGAGGTGGTGCCAGAGAGG - Intronic
1039469820 8:37806435-37806457 TACCCGAGGTGGTGCCAGAGAGG - Intronic
1041422477 8:57683476-57683498 CACTCAATGTCGTGCCTAACAGG - Intergenic
1041462688 8:58129469-58129491 CCCCGAAGGGGGTGGCTGACTGG - Intronic
1047515145 8:125547382-125547404 CAGCAAAGGTGGAGCCTGATAGG + Intergenic
1048984933 8:139730270-139730292 CACCTGAGGTGGGGGCTGACGGG + Intergenic
1049919559 9:350829-350851 CACCAGAGTTGCTGCCTGACAGG - Intronic
1052093918 9:24362013-24362035 CATCCCAGCTGGTGCCTCACTGG - Intergenic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061906826 9:133703295-133703317 CACCCAAGGTGGGGAACGACAGG + Intronic
1062356975 9:136169699-136169721 CACCCTAGATGGGGCCTCACTGG + Intergenic
1186411562 X:9348636-9348658 CCCCCAATGTGGGGCCAGACTGG - Intergenic
1186608620 X:11116557-11116579 CACCCAAGGTTGGGAATGACTGG - Intronic
1191991297 X:67039449-67039471 CACCCCAGCTGGTGTCTCACTGG + Intergenic
1194027466 X:88770611-88770633 CACTCATGGTGGTGCCTGCCAGG + Intergenic
1200393511 X:155968484-155968506 CACCCTAACTGCTGCCTGACCGG + Intergenic
1201506740 Y:14710253-14710275 CTCCCAAGGTGCTGCATTACAGG - Intronic
1202058749 Y:20863910-20863932 CACCCAAAGTAGTGGCTGAAAGG + Intergenic