ID: 1077366210

View in Genome Browser
Species Human (GRCh38)
Location 11:2162361-2162383
Sequence TCACCCCCATAGTGTCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077366202_1077366210 6 Left 1077366202 11:2162332-2162354 CCCTCTCCTGGCCAGGTCCCATG No data
Right 1077366210 11:2162361-2162383 TCACCCCCATAGTGTCATCTGGG No data
1077366201_1077366210 7 Left 1077366201 11:2162331-2162353 CCCCTCTCCTGGCCAGGTCCCAT No data
Right 1077366210 11:2162361-2162383 TCACCCCCATAGTGTCATCTGGG No data
1077366198_1077366210 14 Left 1077366198 11:2162324-2162346 CCCATCTCCCCTCTCCTGGCCAG No data
Right 1077366210 11:2162361-2162383 TCACCCCCATAGTGTCATCTGGG No data
1077366205_1077366210 -5 Left 1077366205 11:2162343-2162365 CCAGGTCCCATGACACCATCACC No data
Right 1077366210 11:2162361-2162383 TCACCCCCATAGTGTCATCTGGG No data
1077366199_1077366210 13 Left 1077366199 11:2162325-2162347 CCATCTCCCCTCTCCTGGCCAGG No data
Right 1077366210 11:2162361-2162383 TCACCCCCATAGTGTCATCTGGG No data
1077366196_1077366210 27 Left 1077366196 11:2162311-2162333 CCTCTTCTGGGAGCCCATCTCCC No data
Right 1077366210 11:2162361-2162383 TCACCCCCATAGTGTCATCTGGG No data
1077366203_1077366210 5 Left 1077366203 11:2162333-2162355 CCTCTCCTGGCCAGGTCCCATGA No data
Right 1077366210 11:2162361-2162383 TCACCCCCATAGTGTCATCTGGG No data
1077366204_1077366210 0 Left 1077366204 11:2162338-2162360 CCTGGCCAGGTCCCATGACACCA No data
Right 1077366210 11:2162361-2162383 TCACCCCCATAGTGTCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077366210 Original CRISPR TCACCCCCATAGTGTCATCT GGG Intergenic