ID: 1077366305

View in Genome Browser
Species Human (GRCh38)
Location 11:2162676-2162698
Sequence TCTCCTGCCCCGAGCGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077366298_1077366305 4 Left 1077366298 11:2162649-2162671 CCGCTCTGCACACACCCAGCCTT No data
Right 1077366305 11:2162676-2162698 TCTCCTGCCCCGAGCGGGTTTGG No data
1077366293_1077366305 28 Left 1077366293 11:2162625-2162647 CCTCAGCCTCGGAACCTCTCGGG No data
Right 1077366305 11:2162676-2162698 TCTCCTGCCCCGAGCGGGTTTGG No data
1077366300_1077366305 -10 Left 1077366300 11:2162663-2162685 CCCAGCCTTTGGCTCTCCTGCCC No data
Right 1077366305 11:2162676-2162698 TCTCCTGCCCCGAGCGGGTTTGG No data
1077366297_1077366305 14 Left 1077366297 11:2162639-2162661 CCTCTCGGGGCCGCTCTGCACAC No data
Right 1077366305 11:2162676-2162698 TCTCCTGCCCCGAGCGGGTTTGG No data
1077366296_1077366305 22 Left 1077366296 11:2162631-2162653 CCTCGGAACCTCTCGGGGCCGCT No data
Right 1077366305 11:2162676-2162698 TCTCCTGCCCCGAGCGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077366305 Original CRISPR TCTCCTGCCCCGAGCGGGTT TGG Intergenic
No off target data available for this crispr