ID: 1077366606

View in Genome Browser
Species Human (GRCh38)
Location 11:2163760-2163782
Sequence CGGGGAAACCAGGCCCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077366587_1077366606 30 Left 1077366587 11:2163707-2163729 CCGAGCCTCTGGAGCTGCTTGGG 0: 1
1: 0
2: 3
3: 37
4: 317
Right 1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG 0: 1
1: 0
2: 2
3: 28
4: 250
1077366590_1077366606 25 Left 1077366590 11:2163712-2163734 CCTCTGGAGCTGCTTGGGGCTCA 0: 1
1: 0
2: 5
3: 27
4: 229
Right 1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG 0: 1
1: 0
2: 2
3: 28
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077366606 Original CRISPR CGGGGAAACCAGGCCCGGAG GGG Intergenic
900142674 1:1145162-1145184 CGGGGAGCACAGGCCAGGAGGGG - Intergenic
900295521 1:1947201-1947223 TGGGGCACCCAGGCCCAGAGAGG + Intronic
900568561 1:3347300-3347322 AGGAGAAACCAGGCCCAGGGAGG + Intronic
901466633 1:9425907-9425929 TGAGGACACCAGGCCCAGAGAGG + Intergenic
901648417 1:10728930-10728952 TGGGAAAACCAGCCCCTGAGAGG + Intronic
901815839 1:11793092-11793114 CGAGAAAACCAGGCTCAGAGAGG + Intronic
903170162 1:21547651-21547673 GGGGAAACCAAGGCCCGGAGAGG + Intronic
903189486 1:21648873-21648895 CTGGGAAGCCAGGCCTGGGGTGG - Intronic
903420862 1:23217221-23217243 CGGGGAACTGAGGCCGGGAGCGG - Intergenic
903802788 1:25982136-25982158 CAGAGAAACCAAGCCAGGAGAGG + Intronic
903832667 1:26184075-26184097 CGGGGAGTCCAGGACCTGAGGGG - Exonic
904490734 1:30857350-30857372 GAGGAAAACCAGGCCCAGAGAGG - Intergenic
905323385 1:37133110-37133132 CAGTGAAACCAGGCACAGAGAGG + Intergenic
906689256 1:47781829-47781851 CTGTGAAACCAAGCCCAGAGAGG - Intronic
906912774 1:49972967-49972989 GGAGGAAATCAGGCCCAGAGAGG + Intronic
907159248 1:52359070-52359092 GCGGGCATCCAGGCCCGGAGTGG - Exonic
907834232 1:58093865-58093887 AGGGGCAAGCAGGCCAGGAGAGG - Intronic
913451951 1:118998640-118998662 TGGGGAAACCAGGCCAGTGGGGG - Intergenic
913521239 1:119647712-119647734 CGGAGAAACCAAGCCCAGGGAGG - Exonic
914760245 1:150592852-150592874 AGGGTAAACCAGGCCAGGTGCGG - Intergenic
915287425 1:154861861-154861883 CAGAGAAACGAGGCCCAGAGAGG + Intronic
919808081 1:201392602-201392624 ACGGGAAACCAGGGCCAGAGTGG + Intronic
920184656 1:204152238-204152260 CCGGGAAGCCAGCCCCGGCGGGG - Intergenic
920574733 1:207050973-207050995 CGGGGAAACCAGGCGCCGGGTGG + Exonic
921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG + Intergenic
923151973 1:231241466-231241488 CAGGGAAAAGAGGCCCAGAGCGG + Intronic
1062916035 10:1241828-1241850 TGGGGAACCGAGGCCAGGAGAGG + Intronic
1064418120 10:15168296-15168318 CGGGGAGGCGAGGCCCGGGGTGG - Intronic
1066672632 10:37857000-37857022 CGGGGATATCAGGCCAAGAGAGG + Intronic
1070760885 10:79023767-79023789 CAGGGAATCCAGGCCAGGGGTGG + Intergenic
1070760917 10:79023932-79023954 AGAGGAAACAAGGCCCAGAGAGG + Intergenic
1070936835 10:80304880-80304902 CAGGCAAACAAGGTCCGGAGTGG + Intergenic
1073254706 10:102143308-102143330 CTGGGAATCCAGGCCAGGCGTGG + Intronic
1076725988 10:132413613-132413635 CGGGGAGACCAGGACGGGAGTGG - Intronic
1076871283 10:133196253-133196275 CAGGGAGACCAGGCAGGGAGGGG - Intronic
1077051870 11:570260-570282 CAGGGAAAACAGGCCGGGTGTGG + Intergenic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1078359560 11:10657849-10657871 TGGGGAACCGAGGCCCAGAGGGG + Intronic
1079183991 11:18220433-18220455 AGGGCAAACCAGGCACAGAGTGG + Intronic
1079540386 11:21565761-21565783 AGAGGAAACCAAGCCCAGAGAGG - Intronic
1079674203 11:23203689-23203711 AGGGCAAGCCAGGCACGGAGGGG - Intergenic
1081495890 11:43609796-43609818 TGGGGAAACCAGTTCCAGAGAGG - Intronic
1081528234 11:43941725-43941747 TGGGAAAACCAGGCACAGAGGGG - Intronic
1082810472 11:57476459-57476481 CGCTGGAACCAGGCCCAGAGCGG - Exonic
1083674697 11:64318897-64318919 AGGGGAAATCAGGCCGGGAGTGG - Intronic
1084461979 11:69301428-69301450 CGGGAAACCAAGGCCAGGAGGGG - Intronic
1086268123 11:85027540-85027562 AGGGGGAGCCAGGCACGGAGTGG + Intronic
1086923752 11:92617746-92617768 CGGGCAAACAAGGTCTGGAGTGG - Intronic
1087014184 11:93540349-93540371 TGTGGAAACCAGGCTCAGAGAGG + Intronic
1088943463 11:114484422-114484444 CTGGGAAAACAAGCCCAGAGAGG - Intergenic
1089270657 11:117299600-117299622 AATGGAAACCAGGCCAGGAGTGG - Intronic
1089690497 11:120184052-120184074 AGTGGAAAACAGGCCGGGAGAGG + Intronic
1092155394 12:6278774-6278796 CGGGGAAGCCAGGGGCGGAGGGG + Intergenic
1092706565 12:11291103-11291125 CAGGAAAACCAGGTCTGGAGTGG + Intergenic
1093182916 12:15987878-15987900 AGGGCAAGCCAGGCGCGGAGTGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1098096701 12:66964588-66964610 CAGGGAAAACTGGCCGGGAGAGG - Intergenic
1102278168 12:111598736-111598758 AGGGGACGCCGGGCCCGGAGCGG + Intronic
1103446346 12:120997465-120997487 CGTGGAGGCCAGGCCTGGAGTGG - Exonic
1103907490 12:124335071-124335093 TGGGGGCACCAGGCCTGGAGAGG - Intronic
1103943066 12:124511404-124511426 TGGAGAAACTAGGCCCAGAGAGG - Intronic
1104346157 12:128001149-128001171 CAGGGGATCCAGCCCCGGAGAGG + Intergenic
1104961250 12:132489674-132489696 CGGGGACCCCAGTCCCGCAGAGG + Exonic
1105011794 12:132761477-132761499 CGGGGAAACCAGGGCCGGTCGGG - Intronic
1113670075 13:112170494-112170516 CGGGGAAGCCAGGCTCCAAGGGG + Intergenic
1114344657 14:21781865-21781887 AGGGTAAGCCAGGCACGGAGTGG - Intergenic
1115790087 14:36868785-36868807 CTGGGAAACCAGGCTTGCAGAGG - Intronic
1117495110 14:56294897-56294919 TGTGGAAGCCAGGCCCAGAGAGG + Intronic
1118776359 14:68976767-68976789 CTAGGAAACCAGGGCCAGAGAGG - Intronic
1120201426 14:81541504-81541526 CAGGAAAACAAGGTCCGGAGTGG + Intergenic
1120748444 14:88174926-88174948 GAGGGCAACCAGGCCCTGAGGGG + Intergenic
1121279283 14:92687733-92687755 CTGGGAAGCCAGGCAGGGAGGGG + Intronic
1121367821 14:93331367-93331389 CCGGGAAACCAGACCCAGAGAGG - Intronic
1121937087 14:98029854-98029876 TGGGGAGACCAGGCACAGAGAGG + Intergenic
1122031114 14:98913259-98913281 TGGGGAAACCAGGCCGAGAGGGG - Intergenic
1122118810 14:99540987-99541009 TGTGAAAACCAGGCCAGGAGGGG - Intronic
1122200964 14:100122341-100122363 CTGGGAAGCCAGGCCCAGAAAGG - Intronic
1122820778 14:104343744-104343766 CAGGGAACCCAGGCTCAGAGAGG - Intergenic
1202922986 14_KI270724v1_random:2426-2448 CGGTGCAACGAGGCCCGCAGCGG - Intergenic
1124347788 15:28934023-28934045 CGGGAAAACAAGGCATGGAGTGG + Intronic
1125201187 15:37101727-37101749 CCGGGAAACCAGCCGCGCAGAGG - Intergenic
1125329063 15:38564722-38564744 CGGGGCTACGAGGCCCGGGGGGG - Exonic
1125586581 15:40824991-40825013 GGGGGATACCAGGCCAGGCGCGG + Intronic
1126738190 15:51752055-51752077 TGGGGGAACAAAGCCCGGAGTGG - Intronic
1127449821 15:59105453-59105475 CGGGGAAAGGCGGGCCGGAGAGG - Intronic
1128306997 15:66605271-66605293 TTGGGAAAACAGGCCCAGAGAGG - Intronic
1129710756 15:77819300-77819322 CGGGGGATGCCGGCCCGGAGCGG - Intronic
1129904853 15:79179282-79179304 TGAGGGAACAAGGCCCGGAGGGG - Intergenic
1130442016 15:83963857-83963879 CAGGCAAACCAGGCCTGGAGTGG + Intronic
1132163674 15:99565443-99565465 CCGGGAGCCCAGGCCGGGAGCGG - Intronic
1132410118 15:101571190-101571212 GGTGGAAACCAGTCCCGGACGGG + Intergenic
1132660083 16:1057437-1057459 CGGGGACACCAGGCTCAGAGGGG + Intergenic
1132688676 16:1172746-1172768 CGGGGCACCCAGGGGCGGAGTGG + Intronic
1132845453 16:1999057-1999079 TGGGGGCACCAGGCCCGGCGGGG + Exonic
1132872016 16:2119554-2119576 TGGGGAAACCAAGCCAGGAGAGG + Intronic
1132997659 16:2831577-2831599 CGGGGAAACTGAGTCCGGAGAGG + Intronic
1134520509 16:14917342-14917364 TGGGGAAACCAAGCCGGGAGAGG - Intronic
1134551065 16:15138632-15138654 TGGGGAAACCAAGCCGGGAGAGG + Intronic
1134708181 16:16315993-16316015 TGGGGAAACCAAGCCGGGAGAGG - Intergenic
1134715397 16:16356026-16356048 TGGGGAAACCAAGCCAGGAGAGG - Intergenic
1134951421 16:18352652-18352674 TGGGGAAACCAAGCCGGGAGAGG + Intergenic
1134959360 16:18396133-18396155 TGGGGAAACCAAGCCAGGAGAGG + Intergenic
1135239034 16:20786919-20786941 CGGGTCAACTAGGCCCGAAGAGG + Intronic
1135586903 16:23678661-23678683 CTGGGAAACCAAACCCGGCGTGG - Intronic
1136016864 16:27406046-27406068 TGGGGAAAGGAGGCCCAGAGAGG - Intronic
1136060604 16:27723763-27723785 CGGGGAACCTAGTCCCAGAGAGG + Intronic
1136230497 16:28882901-28882923 GGGGGAAGCCAGGCCCGGGAGGG - Intronic
1137253815 16:46759090-46759112 CAGGGAAACCTGGCCTGGTGAGG + Intronic
1137907138 16:52334274-52334296 CAGGCAAACAAGGCCTGGAGTGG + Intergenic
1138331880 16:56221875-56221897 AGGGGAAACCAAGGCAGGAGGGG + Intronic
1138450691 16:57092274-57092296 CGGGCAAAGCAGGCCTGGGGAGG + Intergenic
1139283107 16:65786550-65786572 CCGGGACACCAGGCCCAGAGAGG + Intergenic
1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG + Intronic
1141428266 16:83957394-83957416 TGGGGCAACCAGGCCCGAGGAGG + Intronic
1141717094 16:85733086-85733108 CGGAGAAACCAGGCCCCTGGAGG - Intronic
1141747402 16:85934952-85934974 CGGGAAAACGAGGCCTGGGGTGG - Intergenic
1142501971 17:338169-338191 CAGGGAAACCAGGCTGGGCGTGG + Intronic
1143446734 17:7014378-7014400 CGGGAAACCCAGTCCCGCAGAGG - Exonic
1143512905 17:7405680-7405702 GGGGGAAACCAGGCGCAGGGAGG - Intronic
1144208350 17:12994779-12994801 CGGGGACACCATGCCCTGCGAGG - Exonic
1144553948 17:16265450-16265472 CAGGGAAACCAGACCAGGCGCGG + Intronic
1146944260 17:36863319-36863341 CCGGGAACCTGGGCCCGGAGGGG + Intergenic
1147671352 17:42178638-42178660 GGGGGAACCCAGGACCAGAGAGG + Intronic
1147703334 17:42409629-42409651 GGGGGAAACCTGGCCTGGAGTGG - Intronic
1148546452 17:48522761-48522783 CTGGGAAAATAGGCCCAGAGAGG + Intergenic
1148769403 17:50058176-50058198 GGGGGAAACCTGGCCCAGGGAGG - Intronic
1148821358 17:50361612-50361634 AGGGGTAAACAGGCCCAGAGAGG + Intronic
1149637787 17:58184471-58184493 GGGGGAAACCAGGCCCGCCTTGG + Intergenic
1149663198 17:58347054-58347076 GGGGGGAACCAGGCACAGAGAGG - Intronic
1149854890 17:60073612-60073634 TGAGGAAACAAGGCCCAGAGTGG + Intronic
1149963282 17:61136058-61136080 CGGGGAAGGCAGGCGCGAAGGGG - Intronic
1151666156 17:75546198-75546220 GGGGGAGCCCAGGCCAGGAGTGG + Intronic
1151780317 17:76240808-76240830 CGGGATAAACAGGCGCGGAGGGG - Intergenic
1152130402 17:78472731-78472753 AGGGGAAACCAGGGCCAGCGAGG - Intronic
1152229180 17:79106136-79106158 CGGGGGACACAGGCCCGGAGAGG + Intronic
1152530412 17:80915247-80915269 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530449 17:80915527-80915549 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530460 17:80915597-80915619 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530481 17:80915737-80915759 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530492 17:80915807-80915829 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152835600 17:82528690-82528712 CGAGGAAAGCAGGGCCGCAGGGG - Intronic
1152876565 17:82789859-82789881 CCGGGTAAACAGGCCAGGAGGGG - Intronic
1155293107 18:24360840-24360862 AGGGGGATCCAGGCCTGGAGAGG - Intronic
1156554188 18:38048647-38048669 TGGGGAACCAAGGCCCAGAGAGG + Intergenic
1156890742 18:42186948-42186970 CTGGGAAGCCAGGCCAGGAAGGG + Intergenic
1157033736 18:43945795-43945817 CAGGGAAACTAGGCCCATAGAGG + Intergenic
1160241810 18:77130370-77130392 TGAGGAAACAAGGCCCAGAGAGG - Intronic
1160526893 18:79543622-79543644 CAGGGAGACCAGGCCTGGGGAGG + Intergenic
1160554283 18:79715986-79716008 CGGTGAAACCTGTCCCGGACGGG + Intronic
1160689295 19:453787-453809 CGTGGAGCCCAGGCCCGGTGGGG - Intronic
1160856810 19:1221482-1221504 CTGGCAAACCAGGCCCTGCGGGG - Intronic
1161205998 19:3041835-3041857 GGGGGCAGCCAGGCCCAGAGAGG + Intronic
1161399543 19:4061273-4061295 AGGGGAGATCAGGCCCAGAGAGG + Intronic
1162030811 19:7916554-7916576 CGGGGACACCAGGGGCGGATGGG + Intronic
1162291983 19:9786795-9786817 TGGAAAAACCAGGCCTGGAGCGG - Intronic
1162664013 19:12194837-12194859 GGGGGAAACCAGTCCCAGCGAGG - Intergenic
1162808274 19:13150202-13150224 CCGCGAACCCAGGCCGGGAGGGG - Exonic
1162930593 19:13955715-13955737 CGGGGAGACCAGGCCAGGGTGGG - Intronic
1165429656 19:35765257-35765279 TGGAGAAACAAGGCCCAGAGAGG - Intronic
1165738968 19:38194420-38194442 TGGCGAAACCTGGCCTGGAGGGG + Intronic
1167374878 19:49105438-49105460 TGGGGCAACCAGGCCAGGCGTGG + Intronic
1167464377 19:49642389-49642411 CGGCGAAACCTGGCGCCGAGAGG + Intronic
1167501661 19:49851625-49851647 CGGGGGAACCCGGCCCCGGGCGG - Intronic
1168359353 19:55725734-55725756 CAGGGAACCCAGGCCGGGCGCGG + Intronic
1168642582 19:58040022-58040044 CGTGGGAACCAGGCCAGGCGTGG - Intronic
925729014 2:6904111-6904133 CAGGGAAACAAGGTCGGGAGTGG - Intergenic
926055476 2:9771555-9771577 TGGGGGAGCCAGGCCCAGAGAGG - Intergenic
927702310 2:25276301-25276323 GTGGGAAAACAGGCCAGGAGAGG - Intronic
931209857 2:60182207-60182229 CAGGAGAACCAGACCCGGAGAGG - Intergenic
931467663 2:62505819-62505841 CGCGGAGACCAGGCCCGGCCGGG + Intronic
932567247 2:72917774-72917796 CGGGCGAGCCAGGCGCGGAGCGG - Exonic
933923903 2:87075676-87075698 CCCGGAAACCCGGCCGGGAGCGG - Intergenic
936389060 2:112055406-112055428 CTGGGAAACCCGGCCAGGACCGG - Exonic
938080775 2:128368993-128369015 ACGGGAAACAAGGCGCGGAGAGG + Intergenic
938139046 2:128781772-128781794 GGGGGAGACCAGGCATGGAGGGG + Intergenic
938342111 2:130542470-130542492 CGGGGAACTGAGGCCCAGAGAGG - Exonic
938347721 2:130578241-130578263 CGGGGAACTGAGGCCCAGAGAGG + Intronic
938383348 2:130848744-130848766 CAGGGAGACCAGGCCCCGAGGGG + Intronic
938765616 2:134459156-134459178 AGGGGAAGCCAGGCCTGGCGTGG - Intronic
941231002 2:162912673-162912695 CAGAGAAACCAGACACGGAGTGG + Intergenic
946019982 2:216634108-216634130 CGCGGAAGTCAGGCCCGGGGAGG + Intronic
946131299 2:217609067-217609089 CGGGAAAATGAGGCCCAGAGAGG + Intronic
946279666 2:218657718-218657740 TCGGGAAGCCAGGCCCGGCGCGG - Intronic
947537296 2:230948258-230948280 TGGGGAAGTCAGGCCTGGAGGGG - Intronic
947815693 2:233034760-233034782 CTGGGGAGCCAGGCCCCGAGCGG - Exonic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948050368 2:234975317-234975339 TGGGGAAGCCAGGCCTGGCGAGG + Intronic
948126701 2:235569358-235569380 AGGGGACACCTGGCCAGGAGAGG - Intronic
948467439 2:238159075-238159097 CGGGGACCCCAGGCCCGCGGCGG - Exonic
948587707 2:239029618-239029640 CCGGGAAAACAGGCCCTGAGAGG + Intergenic
1169092560 20:2870656-2870678 AGGGGAAAGGAGGCCCCGAGAGG + Intronic
1171987778 20:31672554-31672576 GGGGGAAACCAGGCACACAGAGG - Intronic
1172640710 20:36438907-36438929 TGGGGAAACTAGGCCAGGTGCGG - Intronic
1173384890 20:42578125-42578147 ATGGGAAAACAGGCCCAGAGTGG + Intronic
1174806700 20:53609807-53609829 CCGGGAAGCGTGGCCCGGAGGGG - Intronic
1175248032 20:57593049-57593071 ATGGGAAACCAGGCACGGGGTGG + Intergenic
1175251930 20:57615150-57615172 TGAGGAAACCAGGCCTTGAGGGG - Intronic
1176070242 20:63222461-63222483 GGAGGAAACCATGCCAGGAGGGG + Intergenic
1178488575 21:33033747-33033769 CGGGGAAGCGAGGGCCGGAGAGG - Intergenic
1179474011 21:41631884-41631906 CGGGGATACCAGGAGAGGAGTGG + Intergenic
1179584884 21:42368080-42368102 CGGGGGCACCAGGCCCAGGGTGG + Intergenic
1179729418 21:43359304-43359326 CGGGGAAACCGGGCACGGGCAGG - Intergenic
1181613684 22:24036967-24036989 CATGGAAACCAGGCCGGGTGCGG + Intronic
1181670528 22:24423808-24423830 CGGAGAAACCGAGGCCGGAGGGG - Intronic
1183662418 22:39229470-39229492 CGGGGGAACCAGGACCAGTGGGG - Intronic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
1184473371 22:44708041-44708063 TGGGGAAACCTGGCCAGGCGTGG + Intronic
1184932690 22:47692923-47692945 CGGGGGAACAAGTCCCAGAGGGG - Intergenic
1185065058 22:48627995-48628017 TGGGGGAACCTTGCCCGGAGCGG + Intronic
1185334326 22:50264871-50264893 CGAGGAAACCAGGCCAGCTGTGG + Exonic
950884739 3:16353394-16353416 CGGGGGAACCTGTCCCGGACTGG + Intronic
951557926 3:23939450-23939472 ATGGGAAACCAGGCCAGGAACGG + Intronic
954762485 3:52886414-52886436 CTGGGAAAACAGGCACTGAGAGG - Intronic
961446494 3:126983792-126983814 CGGGGTGGCCAGGCCCGGATAGG + Intergenic
961457674 3:127032253-127032275 CGGGGAAACGAGGCCCACAGAGG - Intronic
963041323 3:141072060-141072082 AGGGGCGACCAGGCCCAGAGGGG - Intronic
964876271 3:161372015-161372037 CGGGGATCCCAGCCCCAGAGCGG - Exonic
968623978 4:1618348-1618370 CAGGAAAACCAGGCCCGGACTGG + Intronic
968636290 4:1682029-1682051 CAAGGAACCCAGGCCTGGAGAGG - Intronic
968878852 4:3288398-3288420 CCAGGAAGCCAGGCCCAGAGGGG - Intergenic
969531847 4:7734694-7734716 TGAGGAAACCAGGCTCAGAGAGG + Intronic
972788321 4:42347295-42347317 AGGGGCAGCCAGGCCCGGAGTGG - Intergenic
974009260 4:56592580-56592602 CGGGGGACCGAGGCCAGGAGAGG + Intronic
974521489 4:62986909-62986931 AGGGCAAACCAGGCACAGAGTGG + Intergenic
976449036 4:85165978-85166000 CAGGTAAACCAGGTCTGGAGTGG - Intergenic
981427146 4:144616580-144616602 AGGGCCAACCAGCCCCGGAGGGG + Intergenic
984278458 4:177638394-177638416 CAGGGAACCCATGCCGGGAGTGG - Intergenic
985517211 5:353210-353232 AGGAGAAACCAAGCTCGGAGCGG + Intronic
989732602 5:44665500-44665522 AGGGCAAGCCAGGCCCAGAGCGG - Intergenic
990513950 5:56514988-56515010 GGGGGAAACTAGGCCCAGAGTGG + Intronic
993617905 5:90136128-90136150 AGGGTAAACCAGGCACAGAGTGG + Intergenic
998822211 5:146067255-146067277 CGGGGAAGGCAGGCCTGGTGTGG - Intronic
1001257567 5:170196028-170196050 TGGGGAAACAGGGCCTGGAGAGG + Intergenic
1002229850 5:177754715-177754737 CAGGCAAACAAGGTCCGGAGTGG + Intronic
1005852104 6:29829560-29829582 CGTGGAGACCAGGCCTGCAGGGG + Exonic
1005859474 6:29889471-29889493 CGTGGAGACCAGGCCTGCAGGGG + Intergenic
1005867038 6:29944264-29944286 CGTGGAGACCAGGCCTGCAGGGG + Exonic
1005875705 6:30008329-30008351 CGTGGAGACCAGGCCCACAGGGG + Intergenic
1005932039 6:30491279-30491301 CGTGGAGACCAGGCCTGCAGGGG + Exonic
1006256405 6:32835874-32835896 AGGGGAAAGCATGCCAGGAGGGG + Intronic
1006788761 6:36685159-36685181 CAAGGAAACCAGGCTCAGAGAGG + Intronic
1007107999 6:39296456-39296478 CGGGGAAACAAGGTCCTCAGTGG - Intergenic
1007258042 6:40542297-40542319 TTAGGAAACCTGGCCCGGAGAGG + Intronic
1009176592 6:60467484-60467506 GGGGGAAAACAGGCCCAGAGAGG - Intergenic
1009458856 6:63888488-63888510 CAGGGAAACAAGGTCTGGAGTGG + Intronic
1012398298 6:98824605-98824627 CGGGGCTCCGAGGCCCGGAGAGG - Intergenic
1012953848 6:105547428-105547450 ATGGGAAAACAGGCCCAGAGAGG - Intergenic
1013471930 6:110473813-110473835 AGGGGAAAACAGGCCAGGTGCGG - Intronic
1014383098 6:120768490-120768512 AGGGGAAGCCAGGCCGGGCGCGG - Intergenic
1015910046 6:138161347-138161369 CAAGGAAACCAGGCCCAGAGAGG - Intergenic
1018933726 6:168259861-168259883 CAGGGAAGCCAGGCCCACAGGGG - Intergenic
1019455063 7:1122696-1122718 GTGGGAAACCAGGCCTGGAAGGG + Intronic
1024198037 7:47079356-47079378 CTGGGAAACCAGACCCAGAAAGG - Intergenic
1026947880 7:74327886-74327908 CGGGGAACCCAGGGCAAGAGCGG - Intronic
1033339125 7:140478714-140478736 CGGGGTGTCTAGGCCCGGAGAGG + Intronic
1036413097 8:8520588-8520610 CGAGGAAATCAGTCCTGGAGTGG - Intergenic
1037818574 8:22124810-22124832 CTGGGAACCCAGGCTGGGAGTGG + Intronic
1038664649 8:29527687-29527709 TGAGGAAAAGAGGCCCGGAGAGG + Intergenic
1038828463 8:31032890-31032912 CGGGGGAGCCGGGCCCGGCGTGG - Exonic
1039833059 8:41233128-41233150 TGAGGAAACCAGGCACTGAGAGG - Intergenic
1039996851 8:42541645-42541667 CGGGGTAAAGAGCCCCGGAGCGG + Intronic
1045029592 8:98122117-98122139 CGGTGTAACCAGGCCAGGTGCGG - Intronic
1045277833 8:100722632-100722654 TTCGGAAACCGGGCCCGGAGGGG - Exonic
1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG + Intergenic
1049585066 8:143429234-143429256 CGTGGACACCAGGCCCGGCCCGG - Exonic
1050537823 9:6645555-6645577 CGGGGGACCGAGGCCAGGAGAGG - Exonic
1053366201 9:37524188-37524210 CAAGGAAACCAGACCCTGAGTGG - Intronic
1053460139 9:38262380-38262402 AGGGAAAACCAGGCCCAGACAGG + Intergenic
1056575106 9:87850396-87850418 AGGAGAAACCAGGCACTGAGGGG - Intergenic
1060204330 9:121673839-121673861 TGGGGAAACCAGGCCCTGAGAGG - Intronic
1061087887 9:128409747-128409769 TGGGGAAAGCAGGCTGGGAGAGG - Intergenic
1061450242 9:130663746-130663768 CGGGGAGTGCAGGGCCGGAGAGG + Intergenic
1062064886 9:134521503-134521525 TGGGAGAACCAGGCCTGGAGAGG + Intergenic
1062467237 9:136686783-136686805 CGGGGAAACCGAGGCCGGGGCGG - Intronic
1203492023 Un_GL000224v1:116280-116302 CAGGCAAACAAGGCCTGGAGTGG - Intergenic
1203504647 Un_KI270741v1:58152-58174 CAGGCAAACAAGGCCTGGAGTGG - Intergenic
1190054149 X:47172150-47172172 TGAGGAAACCAAGCCCTGAGTGG + Intronic
1190287608 X:48971457-48971479 TGGGGAAACCACACCCCGAGGGG + Exonic
1190756865 X:53408934-53408956 GGGGGAAATGAGGCTCGGAGAGG - Intronic
1192799012 X:74448331-74448353 TGAGGAAACCAGGCTCAGAGGGG + Intronic