ID: 1077367688

View in Genome Browser
Species Human (GRCh38)
Location 11:2167727-2167749
Sequence CTGCCAGGCAGCTCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 7, 3: 74, 4: 541}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077367688_1077367693 4 Left 1077367688 11:2167727-2167749 CCTGGAGCAGAGCTGCCTGGCAG 0: 1
1: 0
2: 7
3: 74
4: 541
Right 1077367693 11:2167754-2167776 CACTGATGCTGGTGACAAGATGG 0: 1
1: 0
2: 2
3: 21
4: 212
1077367688_1077367692 -7 Left 1077367688 11:2167727-2167749 CCTGGAGCAGAGCTGCCTGGCAG 0: 1
1: 0
2: 7
3: 74
4: 541
Right 1077367692 11:2167743-2167765 CTGGCAGGAGGCACTGATGCTGG 0: 1
1: 1
2: 2
3: 32
4: 409
1077367688_1077367694 5 Left 1077367688 11:2167727-2167749 CCTGGAGCAGAGCTGCCTGGCAG 0: 1
1: 0
2: 7
3: 74
4: 541
Right 1077367694 11:2167755-2167777 ACTGATGCTGGTGACAAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077367688 Original CRISPR CTGCCAGGCAGCTCTGCTCC AGG (reversed) Intronic