ID: 1077368251

View in Genome Browser
Species Human (GRCh38)
Location 11:2169929-2169951
Sequence CCCACAGCTGGTCCCACAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 257}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077368238_1077368251 10 Left 1077368238 11:2169896-2169918 CCTCCTCCACCTGCTGAGACCCG 0: 1
1: 0
2: 2
3: 34
4: 345
Right 1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG 0: 1
1: 0
2: 1
3: 23
4: 257
1077368237_1077368251 15 Left 1077368237 11:2169891-2169913 CCATGCCTCCTCCACCTGCTGAG 0: 1
1: 0
2: 10
3: 88
4: 1126
Right 1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG 0: 1
1: 0
2: 1
3: 23
4: 257
1077368245_1077368251 -9 Left 1077368245 11:2169915-2169937 CCCGGGGACCTCCACCCACAGCT 0: 1
1: 0
2: 2
3: 35
4: 302
Right 1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG 0: 1
1: 0
2: 1
3: 23
4: 257
1077368243_1077368251 4 Left 1077368243 11:2169902-2169924 CCACCTGCTGAGACCCGGGGACC 0: 1
1: 0
2: 1
3: 25
4: 218
Right 1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG 0: 1
1: 0
2: 1
3: 23
4: 257
1077368244_1077368251 1 Left 1077368244 11:2169905-2169927 CCTGCTGAGACCCGGGGACCTCC 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG 0: 1
1: 0
2: 1
3: 23
4: 257
1077368241_1077368251 7 Left 1077368241 11:2169899-2169921 CCTCCACCTGCTGAGACCCGGGG 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG 0: 1
1: 0
2: 1
3: 23
4: 257
1077368236_1077368251 16 Left 1077368236 11:2169890-2169912 CCCATGCCTCCTCCACCTGCTGA 0: 1
1: 0
2: 2
3: 39
4: 535
Right 1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG 0: 1
1: 0
2: 1
3: 23
4: 257
1077368246_1077368251 -10 Left 1077368246 11:2169916-2169938 CCGGGGACCTCCACCCACAGCTG 0: 1
1: 0
2: 5
3: 37
4: 352
Right 1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG 0: 1
1: 0
2: 1
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077368251 Original CRISPR CCCACAGCTGGTCCCACAGT CGG Intronic
900151029 1:1179470-1179492 CCCACAGCTGGCCCCTCTCTCGG - Intronic
900326123 1:2109546-2109568 CCCACAGCCGGACCCACACCTGG - Intronic
901039474 1:6355300-6355322 CCCACAGCTGTTTCCACACACGG + Intronic
901895304 1:12306897-12306919 CCCACCGCTGATCTGACAGTAGG + Intronic
902290607 1:15432396-15432418 CCCTCAGCTGGCCCCTTAGTGGG + Intergenic
902580345 1:17404004-17404026 CCCTCAGCTGCCCCCACACTGGG - Intergenic
902695855 1:18140467-18140489 CCCACAGCTGCCCCCACTCTAGG - Intronic
903181155 1:21605649-21605671 CCCACAGCCCGACACACAGTAGG + Intronic
904280741 1:29416590-29416612 CGCAGAGCTGGACACACAGTAGG + Intergenic
904316499 1:29669594-29669616 CCCAGGGCTGTTCCCACACTAGG - Intergenic
905246926 1:36621514-36621536 GCCACTGCTGGTCTCACAGGAGG + Intergenic
905649392 1:39646371-39646393 TCCACAGCTGCTGCCACAGCTGG + Intergenic
907334460 1:53691240-53691262 CCTCCAGCTGTACCCACAGTGGG + Intronic
907408680 1:54269775-54269797 ACAACAGCTGGTCCAACAGTGGG + Intronic
907490718 1:54807202-54807224 CACAGAGCTGGACCCACAGTGGG + Intronic
907726330 1:57024055-57024077 CCCTGAGCTGGGCACACAGTAGG - Intronic
909997893 1:82303733-82303755 CCCAAATCTTGTCTCACAGTCGG + Intergenic
911168112 1:94743216-94743238 CTCACACCTGGCCCCACATTGGG + Intergenic
911672503 1:100622722-100622744 CCAACAGCTGTTCCCAGGGTAGG + Intergenic
912799396 1:112711744-112711766 GCCTCAGCTGGGGCCACAGTGGG + Intronic
914992592 1:152511683-152511705 CCCAGAGCTGGAACCACAGCAGG - Exonic
915007853 1:152656448-152656470 CCCAGAGCTAGGCCCACAGCAGG - Intergenic
915008652 1:152664242-152664264 CCCAGAGCTGGGACCACAGCAGG - Exonic
915012310 1:152699026-152699048 CCCAGAGCTGGGACCACAGCAGG - Exonic
915013222 1:152709191-152709213 CCCAGAGCTGGAGCCACAGCAGG - Exonic
915791937 1:158681625-158681647 CTAACAGCAGGTCCCACAGGTGG + Exonic
915952657 1:160199844-160199866 TCTACAGCTGGTCCCATACTGGG + Exonic
917547350 1:175984552-175984574 CCCATAGGTGGTGCCCCAGTAGG - Intronic
917660852 1:177175436-177175458 CACACATTTGCTCCCACAGTGGG + Intronic
918098444 1:181353248-181353270 CCCAGAGCCTGACCCACAGTAGG - Intergenic
918854216 1:189729784-189729806 ACCACAGCTGGTGTCACACTGGG + Intergenic
919835091 1:201567958-201567980 CACACAGCTGGACACACAGCTGG - Intergenic
920296030 1:204957321-204957343 CCTTCTGCTGGTCCCACAGCCGG + Intronic
920442655 1:205991265-205991287 CCCACAGCTGGTCCCAGTGGGGG + Intronic
921759708 1:218898998-218899020 CCCCCAGCTGGTCCTGCTGTAGG + Intergenic
922474767 1:225899282-225899304 CCCAGGGCTGGGCCCTCAGTGGG + Intronic
924419565 1:243895715-243895737 CCCACAGCTGGATCAGCAGTGGG + Intergenic
1064572918 10:16714472-16714494 TCCATAGCTGGTCCAACTGTTGG - Intronic
1067460255 10:46452909-46452931 CTCAGAGCTGGTGCCTCAGTGGG - Intergenic
1067473403 10:46551514-46551536 CCTACAGCTGGGCACGCAGTAGG - Intronic
1067626935 10:47931694-47931716 CTCAGAGCTGGTGCCTCAGTGGG + Intergenic
1068284235 10:54913680-54913702 CCCACAGCTGGTTTCACAGGTGG - Intronic
1069494997 10:68895780-68895802 TCCACAGCCGCGCCCACAGTGGG - Intergenic
1072235053 10:93446532-93446554 GCCTCAGCGGGTACCACAGTGGG + Intronic
1072749177 10:97964532-97964554 CCAACAGCTGGTGCCACATCTGG - Intronic
1073442238 10:103559055-103559077 CACACAGCTGGCGCCTCAGTGGG + Intronic
1073445883 10:103580057-103580079 CCCAGGGCTGGGCACACAGTAGG + Intronic
1074532577 10:114307042-114307064 CCCCAAGCGGGTCCCACATTGGG - Intronic
1075083062 10:119396791-119396813 CCCACAGCAGGTGGCACAGGAGG + Intronic
1075194910 10:120348069-120348091 GCCCCAGCTGGTCTCTCAGTAGG - Intergenic
1076131783 10:128018568-128018590 CCAACAGCTGTTCCCAGAGGAGG + Intronic
1076142024 10:128086827-128086849 CCCACAGCTGGTCTCCCACTTGG + Intergenic
1076538513 10:131198626-131198648 CCCACAGCTGCTCTCCCAGGTGG + Intronic
1076887858 10:133270802-133270824 CCCGCTTCTGGTCCCACAGGTGG - Exonic
1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG + Intronic
1080590237 11:33716999-33717021 CCCTCTGCTGGGCACACAGTAGG + Intronic
1083897830 11:65629023-65629045 CCCACAGAGGGGCCCACAGCAGG + Intronic
1084088454 11:66865475-66865497 CCCACAGCTGGGACCAGAGGCGG + Intronic
1084170581 11:67399068-67399090 ACCACAGCAGGTCACACAGCAGG + Exonic
1084174635 11:67416862-67416884 CCCAGGGCTGGGCACACAGTAGG + Intronic
1084319878 11:68367332-68367354 CCCACAGCAGGTGGCATAGTAGG + Intronic
1084731076 11:71074049-71074071 CCCACAGCTGGTGCCAGAACTGG - Intronic
1085013626 11:73158229-73158251 CCCAGAGCTGGTCCCCTAGCTGG - Intergenic
1085172668 11:74462399-74462421 CCATCAGCTGGTCCCTGAGTGGG - Intronic
1088066132 11:105721743-105721765 CCCTCAGCTATTCCCACAGCAGG + Intronic
1089202189 11:116731269-116731291 CCCACAGCTGCCCCGACAGAGGG - Intergenic
1089812496 11:121143425-121143447 CCCACACCTGGTCTCAAAGGAGG - Intronic
1091704206 12:2682710-2682732 CCCACATTTGTTCCCACACTTGG - Intronic
1091712974 12:2754881-2754903 TCCACAGCTGAGCCCACGGTTGG + Intergenic
1092261964 12:6957706-6957728 CCCGCAGTTGGTCACAGAGTAGG - Exonic
1093687688 12:22076010-22076032 CACACTGCTGCTGCCACAGTGGG - Intronic
1095943542 12:47740994-47741016 CCCTCAGCAGAGCCCACAGTGGG + Exonic
1096218328 12:49810472-49810494 GCCACAGTGGTTCCCACAGTGGG + Intronic
1097820782 12:64127625-64127647 CCCACTGCTGGCCTCACTGTCGG - Exonic
1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG + Intronic
1102491691 12:113293200-113293222 CCCACCCCTGGTGCCACAGTTGG - Intronic
1102515260 12:113441931-113441953 CCCAGAGCTGGGCCCACACAGGG + Intergenic
1102776331 12:115522781-115522803 CCCTGAGCTGGTCCATCAGTGGG - Intergenic
1103862106 12:124023848-124023870 CCCACAGCTGCCCTCACAGCAGG + Intronic
1103898142 12:124287884-124287906 CCGTCAGCTTGTCCCACTGTTGG - Intronic
1104835832 12:131789729-131789751 ACTATAGATGGTCCCACAGTTGG + Intronic
1105017409 12:132794107-132794129 CCCACAGCGGCTCCCACAGTGGG + Intronic
1105898966 13:24740794-24740816 CCCATAGCTGGTCCCTAAATCGG - Intergenic
1106010688 13:25818781-25818803 CACACAGGTGGGCACACAGTAGG - Intronic
1106184987 13:27401466-27401488 GCCACAGCTCGGCCCAGAGTGGG + Intergenic
1111688184 13:91527488-91527510 CCCACAGCTGCTTTCACAGCTGG + Intronic
1113549326 13:111179904-111179926 GTCACTGCTGGTGCCACAGTTGG + Intronic
1114613773 14:24057861-24057883 GCAACAGCTGCTCCCACAGGTGG + Exonic
1114953291 14:27784325-27784347 CCCACAGGTGGCACCACAGAGGG + Intergenic
1117294914 14:54370504-54370526 ACCAGCTCTGGTCCCACAGTAGG - Intergenic
1117558335 14:56909515-56909537 CCTACATCTGGTCCAACAGGAGG + Intergenic
1119433485 14:74583420-74583442 CCAGCAGCTGGGCCAACAGTAGG + Intronic
1119440277 14:74623613-74623635 CCACCAGCTGGCCCCAGAGTGGG + Intergenic
1119536879 14:75409881-75409903 ACCACAGTTGGTCTGACAGTCGG - Intergenic
1119948193 14:78716702-78716724 AACACAGTTGGCCCCACAGTTGG - Intronic
1120349997 14:83342862-83342884 CCCAGAACAGGCCCCACAGTGGG + Intergenic
1121515646 14:94548188-94548210 CCCACATCTGGGCCCACTGATGG - Intergenic
1122871633 14:104641403-104641425 CCCACAGCTGTGACCACAGCTGG + Intergenic
1124095009 15:26641301-26641323 CCCAGAGCTGGAGCCACATTGGG + Intronic
1124190043 15:27566615-27566637 CCCATGCCTGGTCCCGCAGTGGG + Intergenic
1124223242 15:27868006-27868028 GCCCCAGCTCCTCCCACAGTGGG - Intronic
1126489103 15:49216505-49216527 GCCACAGCTGGTGTCACACTTGG + Intronic
1129058361 15:72838647-72838669 GCCACAGGAGCTCCCACAGTGGG - Intergenic
1129162394 15:73753731-73753753 CCCAGAGCTTGGCACACAGTAGG - Intergenic
1132858672 16:2058942-2058964 CCCGCAGCAGGACCCCCAGTGGG - Intronic
1133361231 16:5175380-5175402 GCCCCAGCTGGTGCCCCAGTAGG - Intergenic
1133489483 16:6253338-6253360 CCCACAGCTTGTGTCAAAGTAGG - Intronic
1137614468 16:49838612-49838634 CCCACAGCTGGTGCCGCCCTTGG - Intronic
1138489215 16:57366410-57366432 CTGACAGCTGGTCCCAAGGTGGG - Intergenic
1141678661 16:85531210-85531232 CTCAGAGCTGTGCCCACAGTGGG - Intergenic
1143021952 17:3921512-3921534 CTCACAGCTGGTCACCCAGGAGG - Intergenic
1143617183 17:8059270-8059292 CCAGCAGTTGGTCCCTCAGTCGG + Intergenic
1143729148 17:8870576-8870598 CCCAGAGCAGCTCCCACGGTGGG - Intergenic
1144488541 17:15687485-15687507 GCCACAGCTTGACTCACAGTGGG + Intergenic
1144836382 17:18158651-18158673 CCCACCCCTCTTCCCACAGTGGG + Intronic
1144912471 17:18694820-18694842 GCCACAGCTTGACTCACAGTGGG - Intergenic
1145036354 17:19543444-19543466 CCCACTCTTGGTCCCACAGTTGG + Intronic
1145102389 17:20087948-20087970 CCCCCAGCTCCTCACACAGTGGG - Intronic
1145998190 17:29116309-29116331 CCCACTGATGGCCCAACAGTGGG + Intronic
1146121953 17:30203596-30203618 CCTACAGCTGCCCCTACAGTCGG + Intronic
1147526300 17:41226950-41226972 GCCACAGCTGGACCCACAGCTGG - Exonic
1147527331 17:41238302-41238324 ACCACAGCTGGACCCACAGCTGG - Exonic
1147528453 17:41249971-41249993 GTCACAGCTGGACCCACAGCAGG - Exonic
1147528980 17:41255666-41255688 GCCACAGCTGGACCCACAGCTGG - Exonic
1147529888 17:41265673-41265695 GCCACAGCTGGACCCACAGCTGG - Exonic
1147550337 17:41437439-41437461 TCCACAGGTGGGCCCACAGGTGG + Exonic
1149483160 17:57019604-57019626 CCCACAGCTGCTTTCACGGTAGG + Intergenic
1151322243 17:73359101-73359123 CCCAGAGCTGGGTACACAGTAGG + Intronic
1152612478 17:81322591-81322613 CCCACAGCAGGACCCACAGCGGG - Intronic
1152794852 17:82301845-82301867 CCCAGAGCTGGTCCCGGAGATGG + Intergenic
1152823226 17:82447722-82447744 ACCACAGCTGTTCCTACAGTGGG - Intronic
1155972133 18:32092543-32092565 CCCACGGCTCCTCCCACAGGGGG - Intronic
1158410751 18:57203787-57203809 CCCACATCTGGACACATAGTAGG - Intergenic
1160623998 18:80190526-80190548 CCCACAGCTGGACTTACAGGTGG - Intronic
1160664755 19:320519-320541 GCCACAGCTGGCCGCACAGCAGG + Intronic
1161767577 19:6215942-6215964 GCCAAAGCTGCTCCCACACTGGG + Intronic
1161816281 19:6501909-6501931 GTCACAGCTGGGCCCACAGCTGG - Intronic
1163183049 19:15617399-15617421 GCCACAGCAGGTCCCACTGCAGG - Intronic
1163255036 19:16150967-16150989 TCCCCAGCTTGTCCCACAGAAGG + Intronic
1165359799 19:35329308-35329330 CCCAGAGCTGGGAACACAGTGGG + Intronic
1166143972 19:40821855-40821877 CCCACATCTGCTCCCACAAAGGG - Intronic
1167306531 19:48713278-48713300 CCTCCAGCAGGTCCCACAGCCGG + Exonic
925723091 2:6847075-6847097 CCCACAACTGGCCTCATAGTGGG - Intronic
930029650 2:47050218-47050240 CTGGCTGCTGGTCCCACAGTGGG + Intronic
932126901 2:69152790-69152812 CCCAGTGCTGGTCACACAGTAGG - Intronic
935177495 2:100662603-100662625 CCCTAAGCTGGTCCTAAAGTTGG + Intergenic
935765770 2:106366473-106366495 CCCACACCTGGACACACACTAGG + Intergenic
936815592 2:116456634-116456656 CCCACTGCTGTTACCACAGAGGG - Intergenic
936896066 2:117429027-117429049 CCCAGTGCTGGGCACACAGTGGG - Intergenic
936996292 2:118417457-118417479 CCCACCCCTTGTCCCACAGTGGG + Intergenic
937255237 2:120550831-120550853 CCCAGAGCTGGTCCTACACCCGG - Intergenic
937487236 2:122327814-122327836 CCCAGGGTTGGTCCCACTGTAGG - Intergenic
937916045 2:127099213-127099235 CCCTCAGCTTGGCTCACAGTAGG - Intronic
938571612 2:132566887-132566909 GTCAGAGCTGGTCCCACAGCAGG - Intronic
941138533 2:161747055-161747077 GCCACAGCTGGTGTCTCAGTGGG + Intronic
944025742 2:195165142-195165164 CAAACAGCTGGTCCAACATTAGG + Intergenic
946275434 2:218628180-218628202 CACAAAGCTGGTCCCCCACTAGG - Exonic
946848904 2:223885969-223885991 GCCACAGCCTGTCACACAGTAGG + Intronic
948284598 2:236773920-236773942 GCCACAGCTGGTTCCCCAGGAGG - Intergenic
948570966 2:238916887-238916909 CCCACTCCTGTTTCCACAGTGGG - Intergenic
1169141589 20:3229975-3229997 CCCACGGCTGGTCCCACCTGGGG + Intronic
1169537929 20:6566290-6566312 CCCACAGCTGAACATACAGTAGG + Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1171383390 20:24750702-24750724 CTCACAGCTGGACCCAGAGCCGG - Intergenic
1172116024 20:32574126-32574148 CACACAGCTGTTGCCAGAGTTGG + Intronic
1173713273 20:45179077-45179099 CCCACAGCAGATCCCAAGGTGGG - Intergenic
1174417896 20:50379625-50379647 GCCACAGCTGGCCCCACCGAAGG + Intergenic
1174548734 20:51345689-51345711 CCCAGGGCTGGTACCAAAGTGGG - Intergenic
1174743709 20:53040775-53040797 CTTCCAGCTGATCCCACAGTGGG + Intronic
1175277123 20:57779812-57779834 ACCTCAGCTGGTCCCACGGAGGG - Intergenic
1175317896 20:58064542-58064564 CCCACGTCTTGTTCCACAGTTGG + Intergenic
1175673078 20:60922631-60922653 CCCACAGCTTGTTCCAAAGATGG + Intergenic
1175846051 20:62059126-62059148 CCCCCAGCTTCTCCCACCGTGGG - Intronic
1175895093 20:62332588-62332610 CCCACAGCGGGCCCCCCAGCAGG - Exonic
1176234084 20:64046133-64046155 CCCTCAGATGGGCCCCCAGTAGG - Intronic
1178306337 21:31493823-31493845 ACCACAGCTGGCAGCACAGTGGG + Intronic
1178828057 21:36032600-36032622 CACACAGCAGCCCCCACAGTAGG - Intergenic
1179681469 21:43024270-43024292 CCCACAGCTGGTGAAACAGGTGG - Intronic
1179731013 21:43367516-43367538 CCCACAGCTGCTGCAACAGACGG - Intergenic
1179891014 21:44335133-44335155 CCCTCCGTGGGTCCCACAGTAGG + Intronic
1181473584 22:23155488-23155510 CACACTGCAGGTCCCAAAGTAGG - Intronic
1183599202 22:38830314-38830336 CCCAGAGCCTGGCCCACAGTGGG + Intronic
1184220462 22:43096747-43096769 CCCACAGCAGGACCCAAGGTTGG + Intergenic
950676660 3:14558303-14558325 CCCACAGCCTGGCCCACAATAGG - Intergenic
953722500 3:45368749-45368771 ACCCCAGCTGGTGCCTCAGTAGG - Intergenic
953770808 3:45777583-45777605 CCCACAGCTGGTCTCCAAGAGGG - Intronic
954409260 3:50363229-50363251 CCCACTGCTGGTGCCAGGGTGGG - Intronic
954464733 3:50647755-50647777 CCCAGTGCTGGGCACACAGTGGG + Intronic
954962748 3:54580625-54580647 CACAGGGCTGGACCCACAGTAGG - Intronic
961168325 3:124778910-124778932 CCCTCAGCTTGTCACACAGCTGG - Intronic
961743103 3:129046281-129046303 CCTCCAGCTGGTCCCGCAGCTGG + Intergenic
961887521 3:130106132-130106154 TCCACAGCTGGTCCCATCCTAGG + Intronic
966139923 3:176745378-176745400 CCCACAGCTGTGCCCACATCTGG + Intergenic
966840497 3:184083565-184083587 AGCACAGCTCCTCCCACAGTTGG + Intergenic
968442926 4:633684-633706 CCCACTGCAGGTCGCACAGGTGG + Intronic
968588524 4:1446168-1446190 CACCCTGCTGGTCCCTCAGTGGG - Intergenic
968641977 4:1719610-1719632 AGCACAGCTGGCCTCACAGTCGG - Intronic
969596053 4:8149858-8149880 CACACAGCCGGTCCCTCTGTGGG + Intronic
970905474 4:21211400-21211422 GCCACAGCTGATCCAACAGAAGG - Intronic
977847679 4:101785185-101785207 CACACAGCTGGTCCCTCAGAGGG + Intronic
979434636 4:120673861-120673883 CCCACAGCTGACACCACAGCTGG + Intergenic
981400139 4:144304082-144304104 TCCTCAGCTAGTACCACAGTTGG + Intergenic
981454516 4:144937909-144937931 CCCACCCCTGGTCCCATAGTGGG - Intergenic
985396004 4:189545129-189545151 CCCACAGTTGGGGCCAGAGTTGG + Intergenic
985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG + Intergenic
986564676 5:9100303-9100325 CCCGCAGCTGGGACCACAGGAGG - Intronic
987106786 5:14647470-14647492 CCCACAGATGGTCCAAGGGTGGG + Intergenic
987181908 5:15376629-15376651 CACACAGCTGGTTCCTAAGTTGG + Intergenic
987254712 5:16138545-16138567 CCACCAGGTGGTGCCACAGTGGG - Intronic
989130994 5:38106333-38106355 CCCACAGCTCCTCCAACAGCAGG + Intergenic
990951132 5:61299515-61299537 ACCACAGCTATTCTCACAGTTGG - Intergenic
996884020 5:128334501-128334523 CCCACAGCCAGCCCCACGGTGGG + Intronic
997515912 5:134489865-134489887 CTCACAGCAGTTCCCACAGGAGG + Intergenic
998808930 5:145946360-145946382 CCCACAGCTTGGCCCATATTAGG + Intronic
1001114337 5:168926309-168926331 CCCACACCTTTCCCCACAGTTGG - Intronic
1002780495 6:361536-361558 CACACAGCTGGAGGCACAGTGGG - Intergenic
1005498284 6:26407799-26407821 ACCACAGGTGCTTCCACAGTCGG - Exonic
1006034824 6:31202906-31202928 CCTACAGCTGGCTCCTCAGTGGG - Exonic
1007417993 6:41703232-41703254 ACCACAGCTGGGCACACAGCGGG + Intronic
1007696653 6:43737951-43737973 GCCACAGCTGGTCCCACTGAGGG + Intergenic
1014420887 6:121244472-121244494 CCCACAGCAGGTCCCACCTAAGG - Intronic
1015936149 6:138407536-138407558 CCCACTGCAGCTCTCACAGTTGG + Intronic
1016805258 6:148205890-148205912 CGCTCAGCTGCACCCACAGTGGG - Intergenic
1017336676 6:153269030-153269052 CCCACAGCTGCTGCCACTGCTGG + Intergenic
1018308115 6:162479628-162479650 CTCACATCTGGTCCCACTGGAGG + Intronic
1018395323 6:163373887-163373909 CCCACAGGTGGCACCAGAGTGGG + Intergenic
1018903793 6:168063847-168063869 CCCACAGCTGGTGCCAACCTCGG + Intronic
1020078412 7:5273768-5273790 CAAGCAGCTGGTCACACAGTGGG - Intergenic
1021218993 7:17952534-17952556 TCCACAGCTGGGCCAACTGTTGG - Intergenic
1021384051 7:20006376-20006398 CCCACATCTTGTCCTACAGGAGG - Intergenic
1021835502 7:24669047-24669069 CACACAGCTGTTGCCACACTGGG - Intronic
1022179604 7:27906214-27906236 CTCACAGCTGGACACACAGAGGG + Intronic
1022285281 7:28950875-28950897 CCCACAGCTGATTTCACACTCGG - Intergenic
1023119752 7:36897519-36897541 CCCACAGCTGGTCCTCCTCTTGG - Intronic
1025200482 7:56958425-56958447 CAAGCAGCTGGTCACACAGTGGG + Intergenic
1025252763 7:57362927-57362949 GCCACAGCTGGCCCCACCGAAGG - Intergenic
1025671462 7:63618507-63618529 CAAGCAGCTGGTCACACAGTGGG - Intergenic
1025795610 7:64736872-64736894 GCCACAGCTGGGGCCAGAGTAGG - Intergenic
1028179274 7:87698820-87698842 CCAACAGCTAGTCCCTCTGTTGG - Intronic
1029267278 7:99352324-99352346 CCCACAGCCTGACACACAGTAGG + Intronic
1030723535 7:112898313-112898335 ACCACAGCTGGTGTCACACTTGG - Intronic
1032422314 7:131792452-131792474 CCTACAGCAGGTTCCACAGATGG + Intergenic
1035731175 8:1854330-1854352 CCCACAGCTGTGCCCACGGCGGG - Intronic
1035873661 8:3163713-3163735 CCCACAGCTGCTTCCTGAGTGGG - Intronic
1037884817 8:22590374-22590396 CACACATCTGGTCCCTCAGATGG - Intronic
1038059230 8:23893548-23893570 CCCACAGCTGTTCACATATTTGG + Intergenic
1038351042 8:26776544-26776566 CACACAGCTGGACCCAAACTCGG + Intronic
1038446877 8:27610695-27610717 CCCTCAGCTGTCCCCACAGCAGG + Intronic
1039576570 8:38628515-38628537 GCCACAGCTGGTCCTCCATTTGG - Intergenic
1041321841 8:56621707-56621729 GCCACAGCTGATCTCACAGGAGG + Intergenic
1044543183 8:93430471-93430493 CACACAGCTGGTCACTCAGCAGG + Intergenic
1044839961 8:96329135-96329157 CTCACAGCTGTCCCCACAGTTGG + Intronic
1047544045 8:125797933-125797955 CCCAGATCTGGAGCCACAGTTGG + Intergenic
1049805466 8:144536790-144536812 CCTCCTGCTGGTCCCAGAGTTGG + Intronic
1050663888 9:7913415-7913437 GCCACAGCTGATCTCACAGGAGG + Intergenic
1053157861 9:35792547-35792569 TCCACAGCTAGTGCCACAGCGGG - Exonic
1053673753 9:40399266-40399288 CCCACAGGTCGTGCCACAGAGGG + Intergenic
1053923555 9:43025626-43025648 CCCACAGGTCGTGCCACAGAGGG + Intergenic
1054384858 9:64539331-64539353 CCCACAGGTCGTGCCACAGAGGG + Intergenic
1054510874 9:65977024-65977046 CCCACAGGTCGTGCCACAGAGGG - Intergenic
1055424628 9:76181466-76181488 CCCAAAGCAGGACTCACAGTTGG - Exonic
1057248849 9:93482724-93482746 CACACAGCAGACCCCACAGTGGG + Intronic
1057262389 9:93592283-93592305 CACCCCGCTGCTCCCACAGTGGG - Intronic
1060426396 9:123510248-123510270 CCCAGAGCTGGACCCAGAGTGGG + Intronic
1061812965 9:133173426-133173448 CACACAGCTGGGCACACAGCAGG + Intergenic
1062036769 9:134385934-134385956 CCCGCAGCTGGTGCCGCAGATGG - Intronic
1062284690 9:135767797-135767819 CCCCCAGCTTGTCCCTAAGTTGG - Intronic
1062286841 9:135777139-135777161 GCCACAGCTGTACCCACAGGCGG - Intronic
1187285485 X:17899624-17899646 CCAGAAGCTGGTCCCAGAGTGGG + Intergenic
1187826338 X:23335454-23335476 CCCGCAGCTGCTGCAACAGTTGG + Intronic
1189740868 X:44116091-44116113 CCCAGAGCTGGTACCCCTGTGGG + Intergenic
1190362425 X:49661979-49662001 ACCCCAGCTGGGCCCACAGAAGG - Intergenic
1190824232 X:54002189-54002211 CCAACAGATGGTCTCAAAGTTGG + Exonic
1192631479 X:72781091-72781113 CCCACGGGTGCTCCCAGAGTGGG - Intronic
1192650230 X:72939710-72939732 CCCACGGGTGCTCCCAGAGTGGG + Intronic
1193000664 X:76558880-76558902 GCCACAGCTGGTGCCCCACTAGG + Intergenic
1196119245 X:112030865-112030887 CACAAAGCTGGGCACACAGTGGG - Intronic
1198071240 X:133150576-133150598 CCCACAGCTGATCCAACAGCTGG + Intergenic
1199246006 X:145604768-145604790 CCCCCAGCTGGTGTCTCAGTAGG - Intergenic
1200699548 Y:6390520-6390542 CCCACTTATGGTCCCACAGTGGG - Intergenic
1201034563 Y:9774178-9774200 CCCACTTATGGTCCCACAGTGGG + Intergenic
1201060077 Y:10037163-10037185 CCCACAGCGGTTCCCTCAGGTGG + Intergenic