ID: 1077368310

View in Genome Browser
Species Human (GRCh38)
Location 11:2170200-2170222
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077368305_1077368310 -7 Left 1077368305 11:2170184-2170206 CCAGGCCAGGCGCTAACTGGATT 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1077368310 11:2170200-2170222 CTGGATTAGTGATGGGAAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 264
1077368304_1077368310 -6 Left 1077368304 11:2170183-2170205 CCCAGGCCAGGCGCTAACTGGAT 0: 1
1: 0
2: 1
3: 6
4: 57
Right 1077368310 11:2170200-2170222 CTGGATTAGTGATGGGAAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 264
1077368303_1077368310 -5 Left 1077368303 11:2170182-2170204 CCCCAGGCCAGGCGCTAACTGGA 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1077368310 11:2170200-2170222 CTGGATTAGTGATGGGAAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901569198 1:10145681-10145703 CTGGATGAGTGTTGGGGCGAGGG - Intronic
902338734 1:15768715-15768737 CTGGGGTGGGGATGGGAAGAGGG - Intronic
906289171 1:44608821-44608843 CTGGATCATAGAAGGGAAGAAGG + Intronic
907286360 1:53383022-53383044 CTGGATCAGGGATGGCAAGTAGG - Intergenic
907819422 1:57952600-57952622 CTAGATTCTTGATGGGAGGAAGG + Intronic
909650066 1:77965093-77965115 CAGGATTAGTCATTGGAAAAGGG - Exonic
910537197 1:88311843-88311865 CTTGATCAAAGATGGGAAGATGG + Intergenic
912533881 1:110348508-110348530 CTTGATTAATGTGGGGAAGAAGG - Intergenic
913389987 1:118299970-118299992 CTGGACTAGATATGGGAAGAGGG + Intergenic
914914146 1:151807996-151808018 AAGGATTAGTAATGGGAAGAGGG - Intronic
916505207 1:165422525-165422547 ATGGGCTAGTGATGGGCAGAAGG + Intronic
917010657 1:170467295-170467317 CTGGTTTAGTCTTGGGAGGATGG - Intergenic
918038573 1:180898306-180898328 CTGGATGCCTAATGGGAAGAAGG - Intergenic
918545492 1:185679217-185679239 CTGGAATGGTGATGGGATCAAGG - Intergenic
919843430 1:201625988-201626010 CTGGATTAGGGTTGGAGAGAGGG + Intronic
923425574 1:233865631-233865653 CTGGAGTGGGGATGGGCAGAGGG - Intergenic
923522805 1:234749089-234749111 CTGGGTTGGTGGTGGGAACAGGG + Intergenic
923604068 1:235427539-235427561 CTGGAAAAGAGAAGGGAAGATGG - Intronic
924259941 1:242219438-242219460 CTGGATGACTAATGGAAAGATGG + Intronic
924608512 1:245555213-245555235 CTGGAATGGGGATGGGAGGAGGG + Intronic
1063112642 10:3049965-3049987 CTGCATTGGTGATGGGTGGAGGG + Intergenic
1063862074 10:10321827-10321849 ATGGATTTCTGATGAGAAGATGG + Intergenic
1064418930 10:15173512-15173534 CTGGGCTAGTGCTGGGATGATGG - Intergenic
1064483220 10:15760297-15760319 CCGGACTAGGGAAGGGAAGAAGG - Intergenic
1064794192 10:18992874-18992896 CTCAATTAGGGATGGGAGGATGG + Intergenic
1065517934 10:26543577-26543599 CTGGAATAGTGGTGGGAATGCGG + Intronic
1065630245 10:27672604-27672626 TTGTATTAGTGAGGGAAAGAAGG + Intergenic
1067286003 10:44908108-44908130 CTGGGCTAGTGAGGGGAAGCTGG - Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1067478888 10:46582923-46582945 CTGGCTGAGAGCTGGGAAGAGGG + Intronic
1067615850 10:47758878-47758900 CTGGCTGAGAGCTGGGAAGAGGG - Intergenic
1068547094 10:58359988-58360010 CTGGATTAGACATGGGAAAGAGG - Intronic
1070417417 10:76203943-76203965 ATGGAATAGAGATGGGTAGATGG - Intronic
1070417464 10:76204181-76204203 ATGGAATAGAGATGGGTAGATGG - Intronic
1070417502 10:76204367-76204389 ATGGAATAGAGATGGGTAGATGG - Intronic
1070521551 10:77257978-77258000 CAGGATGAGTGATGTGGAGAAGG + Intronic
1072211204 10:93248685-93248707 ATGGTTTAGTGATGGGAGGGAGG + Intergenic
1072431735 10:95378468-95378490 CTGGACTAGGAATTGGAAGATGG - Intronic
1072520599 10:96226954-96226976 CTGGACTAGGCATGGGAGGAAGG + Intronic
1074619806 10:115107109-115107131 CTGGATTAGTGTTGAGAGGTGGG - Intronic
1074653338 10:115551506-115551528 CTGGATGAGTTTTGGAAAGAAGG - Intronic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076441160 10:130482234-130482256 TTGGATTTGGGATGGGAAAAGGG - Intergenic
1076842740 10:133054224-133054246 CTGGGTCAATGATGGGCAGATGG + Intergenic
1077368310 11:2170200-2170222 CTGGATTAGTGATGGGAAGAGGG + Intronic
1077581524 11:3420418-3420440 CTGGATGAGTCACAGGAAGAAGG + Intergenic
1077985578 11:7347992-7348014 CTGGAGGAGTGAGGGGAAGGGGG + Intronic
1078005840 11:7531627-7531649 CTGGGAAAGTTATGGGAAGAAGG - Intronic
1078420773 11:11210326-11210348 CTGGATTAATGATGTCAGGATGG - Intergenic
1078610087 11:12812228-12812250 CTGAATAAGTGGTGGCAAGAGGG - Intronic
1079868629 11:25766837-25766859 TTGCATTAGTGATGGTAACAAGG - Intergenic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1083062057 11:59884067-59884089 CTGGTTTACTATTGGGAAGAAGG + Intergenic
1083694100 11:64431064-64431086 CTGGGTGAGTGATGGGTATATGG - Intergenic
1084095704 11:66909732-66909754 CTGAACTAGTGATGGGAGGAGGG + Intronic
1084238437 11:67803236-67803258 CTGGATGAGTCACAGGAAGAAGG + Intergenic
1084680014 11:70661653-70661675 CTGCATTATTGAGGAGAAGACGG - Exonic
1084833972 11:71789589-71789611 CTGGATGAGTCACAGGAAGAAGG - Intronic
1085297490 11:75439274-75439296 CTGGAGAAGGGATGGCAAGAGGG + Intronic
1085406899 11:76268788-76268810 ATGGATGGGTGATGGGTAGATGG - Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1086411021 11:86544585-86544607 CTGGTTTAGTCTTGGGAGGAGGG - Intronic
1088018846 11:105094289-105094311 CAGGATTGGTGATGAGAAGCCGG + Intronic
1088205985 11:107393191-107393213 CTGCATAAGTGATGGGCACATGG - Intronic
1088680311 11:112235935-112235957 CTGAATCAGTGGTGGGAACAAGG - Intronic
1088740752 11:112765071-112765093 CTGGGCTAGTGCAGGGAAGAGGG + Intergenic
1089452231 11:118606846-118606868 CTGGATTACAGATTGGGAGATGG - Intronic
1090458796 11:126871609-126871631 CTGGATTATTGAGGGGCAAAGGG + Intronic
1090697223 11:129259073-129259095 ATGCATTACTGATGGGAAAAAGG + Intronic
1091337443 11:134783029-134783051 CTTGGGGAGTGATGGGAAGAAGG - Intergenic
1091989901 12:4946869-4946891 CTGCACTAGTGATGGGAAGAAGG - Intergenic
1092409129 12:8240877-8240899 CTGGATGAGTCACAGGAAGAAGG + Intergenic
1094476866 12:30847134-30847156 CTGGATTAGAGAGGAGAAAAGGG - Intergenic
1094477451 12:30852179-30852201 CTGGTTTAGTGATGGATAGGGGG + Intergenic
1095897942 12:47299661-47299683 CTGCAGCAGTGATGGGGAGAGGG - Intergenic
1096803014 12:54123939-54123961 CCAGATGAGTGATGGGAAGAGGG - Intergenic
1098663949 12:73136241-73136263 ATGGACTAGGGATGGGAGGATGG + Intergenic
1102330231 12:112022559-112022581 CAAGATGAGTGACGGGAAGAAGG + Exonic
1103017703 12:117508619-117508641 CTAGATTAATGGTGGGAAGATGG + Intronic
1105468650 13:20671647-20671669 GTAGATTGTTGATGGGAAGAAGG - Intronic
1106167260 13:27259170-27259192 CTGCTTTAATGAAGGGAAGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1108163567 13:47668227-47668249 CTGGTTTAGTCTTGGGAGGAGGG - Intergenic
1109953978 13:69541332-69541354 GAGGAATAGGGATGGGAAGAGGG - Intergenic
1109985580 13:69979469-69979491 TTGGATATGTGATGGGAAGAAGG - Intronic
1113902609 13:113805137-113805159 CTGGATTAGGGATGGGAGGTGGG + Intronic
1113934170 13:113984666-113984688 ATGGATGAGTGATGGGTGGATGG - Intronic
1113934552 13:113986824-113986846 ATGGATGAGTGATGGGTGGATGG - Intronic
1113934847 13:113988576-113988598 ATGGATGAGTGATGGGTGGATGG - Intronic
1113934911 13:113988872-113988894 ATGGGTGAGTGATGGGCAGATGG - Intronic
1113935059 13:113989550-113989572 ATGGATGAGTGATGGGTGGATGG - Intronic
1117348065 14:54853418-54853440 CTTGATTTGGGATGGGAAAAGGG + Intronic
1117513077 14:56472186-56472208 GAGGATAAGTGATGGGAACATGG - Intergenic
1118576132 14:67242809-67242831 CTGAATTAGTTTTGGCAAGACGG + Intronic
1118691432 14:68344127-68344149 CTTGTGGAGTGATGGGAAGAGGG + Intronic
1120408819 14:84124188-84124210 CTAGATTAGTGTCGAGAAGAAGG - Intergenic
1122023425 14:98858142-98858164 AGGGATTAGCCATGGGAAGAGGG + Intergenic
1122863096 14:104591339-104591361 CTGGATCAGGGCTGGGCAGAGGG + Intronic
1125183589 15:36905542-36905564 CTGGGTTTGGCATGGGAAGAGGG + Intronic
1127794798 15:62428223-62428245 GTGGAAGAGTAATGGGAAGAGGG + Intronic
1128256508 15:66201199-66201221 CTGGACTTGTGGTGGGATGAGGG - Intronic
1128971659 15:72112774-72112796 CTGGATTAGTGACTAGAAGAAGG + Intronic
1130966686 15:88702572-88702594 CTGGAGTAGGGAGGGGCAGAAGG - Intergenic
1131074851 15:89488950-89488972 CTGGAATAGTTAAGGGTAGAGGG + Intronic
1132993933 16:2813006-2813028 CTGTCTTAGTGAGGGGAAGGAGG + Intergenic
1133045901 16:3088143-3088165 CTGGGTTATTGAGGGGAATAAGG - Intergenic
1133350094 16:5095686-5095708 CTGGATGAGTCACAGGAAGAAGG + Intronic
1133696099 16:8264349-8264371 ATGGATTAGATATGGAAAGAGGG - Intergenic
1133864929 16:9633524-9633546 CTGACTTACTGATGGGCAGATGG - Intergenic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1138514882 16:57530547-57530569 GTGGGTTAGAGATTGGAAGAAGG - Intronic
1139431804 16:66914763-66914785 TTGGATGAGTGATGGGAGGTTGG + Intronic
1141475842 16:84272772-84272794 ATGGATGAATGATGGGAGGATGG - Intergenic
1142782073 17:2189211-2189233 CTGAAAAAGTGACGGGAAGAGGG - Intronic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1143617913 17:8064463-8064485 GTGGATCAGTGAGTGGAAGAGGG + Intergenic
1144100710 17:11939896-11939918 ATGGATGGGTGATGGGTAGATGG + Intronic
1146269151 17:31473109-31473131 GTGGCTGAGTGATGGGAAGGTGG + Intronic
1147322855 17:39656604-39656626 ATGGATTATGGCTGGGAAGATGG + Intronic
1148871331 17:50660362-50660384 CTGGATTGTGGATGGGAGGAGGG - Intronic
1149984939 17:61340238-61340260 CTAGCATAGTGATGGCAAGAGGG + Intronic
1150293908 17:63998097-63998119 CTGGGTTAGTGCGGGGAAGGGGG - Intergenic
1152004056 17:77666437-77666459 CTGCATTATTAATGGGAAGCCGG - Intergenic
1152243981 17:79175767-79175789 CTGGATTGGTGGTGGGCAGCAGG + Intronic
1154308285 18:13246463-13246485 CTTGATTGGTGATGAGGAGATGG + Intronic
1155443466 18:25885419-25885441 CTGGGTTAGTGATGGGTATGGGG + Intergenic
1156381978 18:36571018-36571040 GTGCAATAGGGATGGGAAGAGGG + Intronic
1156995424 18:43460353-43460375 CTGGATTATTGAGGCCAAGAAGG + Intergenic
1156997002 18:43480920-43480942 CTGACTTAATGATGAGAAGATGG + Intergenic
1157170928 18:45404439-45404461 CTTCATTACTAATGGGAAGAAGG - Intronic
1158682660 18:59582583-59582605 CTGGAGTAGTGATGGGGGAAGGG + Intronic
1159160635 18:64639778-64639800 GAGGATGAGTGATGGGCAGAAGG + Intergenic
1159398523 18:67897953-67897975 CTGTTTTAGTCATGGTAAGAAGG + Intergenic
1159750597 18:72296413-72296435 TGGGGTTAGGGATGGGAAGAGGG - Intergenic
1162273130 19:9632511-9632533 CTTGAGTAGTTAAGGGAAGAAGG - Intronic
1163295329 19:16408049-16408071 ATGGATAAGGGAAGGGAAGATGG + Intronic
1163740188 19:19007052-19007074 CTGGCTCAGTAATGGGAAGATGG + Intronic
1164737281 19:30551285-30551307 CTTCATTACTGATAGGAAGATGG - Intronic
1165442652 19:35839237-35839259 CTGGGGTAGTGATGGGAAGCTGG + Exonic
1166215404 19:41331330-41331352 CCGAATTGGAGATGGGAAGAGGG - Intronic
1166365295 19:42275193-42275215 CTGGATTACAGATGGGCAGATGG + Intronic
1166719224 19:44987932-44987954 CTGGGTCAGAGATGGGCAGATGG - Intronic
1167821231 19:51929691-51929713 GTGGATTAATGATGAGTAGAAGG - Intronic
925995298 2:9287847-9287869 CTGCATTAGTCATGGAAGGAGGG + Intronic
926580504 2:14629195-14629217 CTGGATTAGAGATGGTTATATGG - Intergenic
928791399 2:34959810-34959832 CTGGATTATTTGTGGGAAAAGGG - Intergenic
929082507 2:38135132-38135154 CTGGTTTAGTCTTGGGAGGATGG + Intergenic
930093748 2:47551165-47551187 CTGGAATAGTGTTTGGAGGAGGG - Intronic
930583957 2:53247927-53247949 CTGGGTTTGTGATGGGTAGCAGG - Intergenic
930998249 2:57748892-57748914 CTGCTTTAGTGAAGGGAAGATGG - Intergenic
931617196 2:64171790-64171812 ATGATTTAGTGAAGGGAAGAAGG - Intergenic
932288931 2:70559008-70559030 AGGAACTAGTGATGGGAAGAGGG + Intergenic
932337861 2:70941238-70941260 ATGGAATAGTGCTGGGAATATGG - Exonic
936272422 2:111059263-111059285 CTGGAATTGGGATGGGAACAAGG + Intronic
936652328 2:114442262-114442284 CTGGGTTAGGGGTGGGGAGAGGG + Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937289317 2:120772540-120772562 CTGGCTGAGTGATAGGAAGGAGG + Intronic
938114464 2:128593966-128593988 CTGGAGTAGAAATGGAAAGAAGG - Intergenic
942371748 2:175293191-175293213 GAGGATTTGTGAAGGGAAGATGG - Intergenic
944647723 2:201796139-201796161 CTGGGATTGAGATGGGAAGAGGG + Intronic
945381136 2:209142265-209142287 CTAGATTATTAATGGGAACAGGG - Intergenic
946667310 2:222064545-222064567 TTGGATTAGTGTTGTTAAGAAGG + Intergenic
1168764190 20:370922-370944 ATGGATAAGTGATGGAAAAATGG + Intronic
1170225384 20:13986407-13986429 CTGGATTAGGGAATGGCAGAGGG - Intronic
1170367503 20:15613975-15613997 GTGAATGAGAGATGGGAAGAAGG + Intronic
1171793746 20:29550649-29550671 CCAGATGAGTGATGGGAAGAGGG + Intergenic
1171854724 20:30333741-30333763 CCAGATGAGTGATGGGAAGAGGG - Intergenic
1172129265 20:32645034-32645056 CTGGCTTAGGAATGGGAAGGGGG - Intergenic
1172998653 20:39090034-39090056 CTGAATCAGAGTTGGGAAGATGG + Intergenic
1173350487 20:42240754-42240776 CTGAATTAATGATGGAAAGATGG - Intronic
1176996182 21:15558056-15558078 CTGGCAAAGTGAAGGGAAGATGG - Intergenic
1179078838 21:38151104-38151126 CTTGACTATTGATAGGAAGAAGG + Intronic
1181746362 22:24957496-24957518 CTGGATGGGTGAGTGGAAGAAGG - Intronic
1181928669 22:26381216-26381238 AAGGATTTGTGATGGGAAAAAGG + Intronic
949211962 3:1513845-1513867 CTGGAAGAGTGAGGGGAGGAAGG - Intergenic
950406536 3:12808572-12808594 CTGGCCTAGTGTTGGGAACATGG + Intronic
950567251 3:13777371-13777393 ATGGAATAGGGAAGGGAAGATGG + Intergenic
950984100 3:17341909-17341931 CTGTATTGGGGATGGGAAGAGGG - Intronic
952036766 3:29212359-29212381 CTGGAATGGCGATGGGGAGATGG + Intergenic
952650387 3:35719666-35719688 CAGAATTAGTAATGGGAACAAGG + Intronic
953515107 3:43582948-43582970 CAAGAGTAGTGATAGGAAGAAGG - Intronic
953539500 3:43803591-43803613 CTGGTTTAGTGTTGGGAGGGTGG + Intergenic
956731796 3:72203521-72203543 AGGGATTAGTGATAGGAGGAAGG + Intergenic
961140554 3:124552316-124552338 CAGGACTGGAGATGGGAAGAGGG - Intronic
961300454 3:125918670-125918692 CTGGATGAGTCACAGGAAGAAGG - Intergenic
961888057 3:130109408-130109430 CTGGATGAGTCACAGGAAGAAGG + Intronic
963370511 3:144393722-144393744 CTGGCTTATTGACGGGAAAAAGG + Intergenic
964224526 3:154382958-154382980 CAGGATTAGGGTTGGGATGAGGG + Intronic
966751929 3:183330487-183330509 AGGGATTAGGGATGGGGAGAGGG + Intronic
967593146 3:191301102-191301124 CTGGGTTAGTCAAGGAAAGAAGG - Intronic
968997200 4:3953345-3953367 CTGGATGAGTCACAGGAAGAAGG + Intergenic
969756813 4:9155329-9155351 CTGGATGAGTCACAGGAAGAAGG - Intergenic
969816781 4:9692906-9692928 CTGGATGAGTCACAGGAAGAAGG - Intergenic
970265087 4:14273824-14273846 CTGTCTAAGTGATGGCAAGAAGG - Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
972284831 4:37638107-37638129 AGAGAATAGTGATGGGAAGAAGG - Intronic
973991555 4:56413557-56413579 ATGGAGTATTGATGGGAAGAAGG + Intronic
976335138 4:83876922-83876944 CTGGATTAGGCAGAGGAAGAAGG + Intergenic
976614453 4:87062104-87062126 CTGTATGAGTGATGAGAAAATGG + Intronic
976828759 4:89289331-89289353 CAGAATTAGTGATGTCAAGAGGG - Intronic
977085625 4:92594118-92594140 CTGGACTAGTGATGTAAAGGAGG - Intronic
979545999 4:121940567-121940589 CTGGACCACTGATGGTAAGAAGG - Intronic
984175182 4:176408768-176408790 CTGGATAAGTGACAGGAAAATGG + Intergenic
986712509 5:10498240-10498262 CTGGATGGGTGAGGGGAGGAGGG + Intergenic
987093178 5:14525458-14525480 CTGGCCTAGCCATGGGAAGAAGG - Intronic
990363642 5:55047317-55047339 CTTCATTACTGCTGGGAAGATGG + Intergenic
991031153 5:62083681-62083703 TTGGATTAGGGATAGTAAGATGG - Intergenic
991256966 5:64624477-64624499 CTGAATTGGGGATGGGAAGAGGG - Intergenic
995816922 5:116180464-116180486 CTGTATTAGTGTTGGGATAATGG + Intronic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
997207048 5:132056276-132056298 GGGGGTGAGTGATGGGAAGAAGG + Intergenic
997808549 5:136944143-136944165 CTGGTTTAGTCTTGGGAGGAGGG + Intergenic
998188294 5:139999959-139999981 CTCGCTAAGTGATGGGATGATGG + Intronic
998547663 5:143044636-143044658 CAGGATTATTGATAGGAAGATGG + Intronic
1000293066 5:159889322-159889344 GTGTATTTGTGATGGGGAGAGGG - Intergenic
1001144879 5:169175125-169175147 GTGTCTTAGTCATGGGAAGAAGG + Intronic
1001285259 5:170418447-170418469 CTGGAGAAATGATGGGAAGAGGG - Intronic
1001581728 5:172803135-172803157 CTGGAGCACTGTTGGGAAGAGGG + Intergenic
1002469311 5:179426031-179426053 CTGGATAGGCAATGGGAAGATGG - Intergenic
1003802846 6:9690791-9690813 CTGGATTAGTGCTGTCAACATGG - Intronic
1005956228 6:30665332-30665354 CGGGGGTAGTAATGGGAAGAGGG - Intronic
1009848720 6:69167786-69167808 CTGTATTAGAGATGGATAGAAGG + Intronic
1009891567 6:69690237-69690259 CTGGATTAGTCAGGGATAGATGG - Intronic
1011050315 6:83140694-83140716 TGGGATTAGGGATGGGAACAGGG - Intronic
1013259459 6:108426819-108426841 GTGGAGGAGGGATGGGAAGAGGG - Intronic
1013396108 6:109741707-109741729 GTGGATTTTGGATGGGAAGAGGG - Intronic
1015107770 6:129556795-129556817 GTGTTCTAGTGATGGGAAGAAGG - Intergenic
1016775032 6:147895973-147895995 TTTGATTAGTGAAGGCAAGAGGG + Intergenic
1019478000 7:1253185-1253207 CGGGATTAGTGATGAAATGAAGG - Intergenic
1019503722 7:1379902-1379924 TTGGATGGGTGATGGAAAGATGG + Intergenic
1019573537 7:1725133-1725155 CAGGATTAGGGAGGGGAAGCAGG + Intronic
1021673563 7:23057821-23057843 CTGGATCTGGGAAGGGAAGAAGG - Intergenic
1021838659 7:24705067-24705089 CTGGATCAGTGATGCCAAGTAGG - Intronic
1022043563 7:26603787-26603809 CTGCATTAGTCATGGGCAGAGGG + Intergenic
1022250569 7:28603472-28603494 CAGGAATAGTGATGGGGAGCTGG - Intronic
1022965570 7:35468396-35468418 CTGGATGGGAGCTGGGAAGAGGG - Intergenic
1023279898 7:38558567-38558589 CAGGAATAATGATGGGAAGGAGG + Intronic
1023478113 7:40602953-40602975 CTGCAGTAGTGATGGGATGTTGG + Intronic
1029431443 7:100533513-100533535 GTGGAGTAGAGATGGGAGGAGGG + Intergenic
1029796099 7:102896090-102896112 CTGGAGTAGAGTTGGCAAGAAGG + Intronic
1033651634 7:143347891-143347913 GTGGACTAGTGATTGGAAGCAGG + Intronic
1033969384 7:147020803-147020825 CTGGATTTATGCTGGGATGAAGG - Intronic
1035334366 7:158116275-158116297 ATGAATTAGTTTTGGGAAGATGG + Intronic
1035702906 8:1650929-1650951 CTGGAGCAGAGATGGGAGGACGG + Intronic
1036380044 8:8230649-8230671 CTGGATGAGTCACAGGAAGAAGG - Intergenic
1036614978 8:10381032-10381054 ATGGATAAATGATGGAAAGATGG + Intronic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1036849515 8:12192013-12192035 CTGGATGAGTCACAGGAAGAAGG + Intronic
1036870877 8:12434286-12434308 CTGGATGAGTCACAGGAAGAAGG + Intronic
1036968679 8:13329509-13329531 CTGTAGTTGTGATGGGAAGGAGG - Intronic
1038195875 8:25367160-25367182 TGGGATGACTGATGGGAAGATGG - Intronic
1038679144 8:29650978-29651000 CATTATTAGTGATGGGAGGAAGG - Intergenic
1041358691 8:57027707-57027729 CTGTTTTAGTGATGGGGATATGG + Intergenic
1041893100 8:62893587-62893609 CTGGAGAAGTGAGGGGAAGCCGG + Intronic
1042979638 8:74510818-74510840 CTGGATTACTGATCTAAAGAAGG - Intergenic
1044182859 8:89217510-89217532 GTGGATTAGTGTAGGGAAGTAGG + Intergenic
1044235153 8:89822074-89822096 CTGGTTTAGTCTTGGGAAGGGGG + Intergenic
1045382096 8:101637212-101637234 CTGGATTATTGATGAAAGGATGG - Intronic
1045398463 8:101785637-101785659 CTGGGTTAGTACAGGGAAGACGG + Intronic
1046892894 8:119442417-119442439 CTGAATTGGGGGTGGGAAGATGG + Intergenic
1048444357 8:134482113-134482135 CAGGCTTAGTGATGGGCAGAAGG - Intronic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1053792549 9:41697022-41697044 CCAGATGAGTGATGGGAAGAAGG - Intergenic
1054180962 9:61909043-61909065 CCAGATGAGTGATGGGAAGAAGG - Intergenic
1054472402 9:65548946-65548968 CCAGATGAGTGATAGGAAGAAGG + Intergenic
1054656629 9:67672099-67672121 CCAGATGAGTGATGGGAAGAAGG + Intergenic
1056209957 9:84356276-84356298 ATGGGTTAATGATGGGAGGAGGG - Intergenic
1056706717 9:88958322-88958344 CTGGAAGAGTGAGGGGAAGCAGG - Intergenic
1058022619 9:100105152-100105174 CTGGATTTGTGATAGAAAGATGG - Intronic
1058644239 9:107115916-107115938 CTGGATTAGAAACTGGAAGATGG + Intergenic
1059217705 9:112581603-112581625 CTGGATGAGTGAGGGAAATAAGG - Intronic
1061487651 9:130928516-130928538 CTGGGTGACTGATGGGAAGGTGG - Intronic
1062388759 9:136325880-136325902 CTGGGTTAGTGGTGGGAGGCTGG - Intergenic
1185657833 X:1700324-1700346 CTGGAATATTCATGGGAAAATGG + Intergenic
1187172938 X:16869793-16869815 CTGGAGGAGGGAAGGGAAGAGGG + Exonic
1188239497 X:27768287-27768309 CAGGTTTGGTGGTGGGAAGATGG + Intergenic
1190284723 X:48954564-48954586 CAGAATTAATGATGGGAGGAAGG + Intronic
1192033413 X:67539229-67539251 CTGGATTGGAGATGAAAAGAGGG - Intergenic
1192211964 X:69133359-69133381 CTGAAGTAGGGATGGGAAGCTGG - Intergenic
1192679941 X:73241950-73241972 CTGTGATGGTGATGGGAAGAGGG + Intergenic
1192705362 X:73523872-73523894 CTGGACCAGTGATGGCAAGAAGG + Intergenic
1193560833 X:83013996-83014018 GTTGATTCGTGATGGTAAGATGG + Intergenic
1194403254 X:93463092-93463114 CATCATTAGTGATGGGAAAATGG + Intergenic
1195274071 X:103262227-103262249 CAGGGGTAGAGATGGGAAGATGG - Intergenic
1195799679 X:108693728-108693750 GTTGATTAGCTATGGGAAGAAGG + Intronic
1195965314 X:110424764-110424786 CTGGGTTAGTGGTGAGAACAAGG + Intronic
1197113955 X:122809539-122809561 CTGAAATAGTGATTTGAAGAGGG - Intergenic
1199023036 X:142904709-142904731 CTGGATTAGTTGTGGGGAGGTGG + Intergenic
1199113982 X:143968372-143968394 CTGGGGTATTGATGGGAGGAAGG + Intergenic
1199942633 X:152640150-152640172 CTGGATTAAAGCTGGGAAGGTGG + Intronic
1200184303 X:154171879-154171901 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200189955 X:154209012-154209034 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200195708 X:154246821-154246843 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200201362 X:154283937-154283959 CTGCATTGCTGGTGGGAAGATGG + Intronic
1200925662 Y:8652215-8652237 CTGGATTAGTATTTGGAAAATGG + Intergenic