ID: 1077368363

View in Genome Browser
Species Human (GRCh38)
Location 11:2170399-2170421
Sequence AGCCAGGAGCGGGCGCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077368363_1077368371 13 Left 1077368363 11:2170399-2170421 CCCGCAGGCGCCCGCTCCTGGCT 0: 1
1: 0
2: 0
3: 20
4: 219
Right 1077368371 11:2170435-2170457 TCCACCCTTTGTCATAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 91
1077368363_1077368376 20 Left 1077368363 11:2170399-2170421 CCCGCAGGCGCCCGCTCCTGGCT 0: 1
1: 0
2: 0
3: 20
4: 219
Right 1077368376 11:2170442-2170464 TTTGTCATAGCTCTGGGCGCAGG 0: 1
1: 1
2: 3
3: 74
4: 833
1077368363_1077368373 14 Left 1077368363 11:2170399-2170421 CCCGCAGGCGCCCGCTCCTGGCT 0: 1
1: 0
2: 0
3: 20
4: 219
Right 1077368373 11:2170436-2170458 CCACCCTTTGTCATAGCTCTGGG 0: 1
1: 0
2: 1
3: 8
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077368363 Original CRISPR AGCCAGGAGCGGGCGCCTGC GGG (reversed) Intronic
900156754 1:1206236-1206258 CGCCAGCAGCGGGAGCCTTCCGG - Intronic
900384233 1:2402148-2402170 AGCCAGCACCGGGCACCTGCCGG - Intronic
900574670 1:3377182-3377204 AGCCAGGAGCTGGCGGGAGCCGG - Intronic
900577916 1:3393559-3393581 AGCCAGGAGCCGGCGCAGGCTGG + Intronic
901049440 1:6419046-6419068 CGCCGTGAGCGCGCGCCTGCTGG - Exonic
901212382 1:7533966-7533988 AGCCAGGAGCAGGGCCCTTCTGG + Intronic
901526107 1:9824171-9824193 CGCCTGGAGCGCGCGCCCGCGGG + Exonic
901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG + Intronic
901756076 1:11442361-11442383 AGCCAGGGTCGGGTGACTGCTGG + Intergenic
902755716 1:18548033-18548055 AGCCAGAAGCAGGAGCCAGCGGG + Intergenic
903069198 1:20718142-20718164 AGCCACGCGCGGCCGCTTGCGGG + Intergenic
903390990 1:22963418-22963440 AACCAGGAGCTGTGGCCTGCAGG - Intronic
905884471 1:41484418-41484440 AGACAGGGGCGGGAGCCTGGCGG - Intronic
906251119 1:44311765-44311787 AGCCAGGACCTGGCTCCTGAGGG - Intronic
909828303 1:80153952-80153974 AGCCAGGAGATGGCGCTTTCAGG + Intergenic
910468793 1:87528871-87528893 AGCCAGGAGCGGCAAACTGCTGG - Intergenic
914196994 1:145452726-145452748 AGCCTGGGGCTGGCCCCTGCTGG - Intergenic
914357177 1:146896869-146896891 AACCAGGAGGGGGAGCTTGCCGG + Intergenic
914431700 1:147624756-147624778 GGCAAGGATCGGGGGCCTGCCGG + Exonic
916256290 1:162790919-162790941 AGCCAGGGGCGGGCGCTTCCGGG - Intronic
916681596 1:167109730-167109752 AGCCAGGAGGTGGCACCTTCAGG - Intronic
916759277 1:167802032-167802054 AGCCAGGATAGGGTGCATGCCGG + Intergenic
919486923 1:198157321-198157343 TGCCGGGAGGGGCCGCCTGCGGG + Intronic
920066426 1:203272917-203272939 ACCCAGGTGCGGACTCCTGCGGG + Intronic
920385422 1:205568002-205568024 AGCCAGGATCTGGCCCCTGGAGG - Intergenic
924803362 1:247343981-247344003 AGCCAGGAGGGGCAGCCTACAGG + Intergenic
1065993254 10:31032487-31032509 AGCCAGGGGCGGGAGCCGGAAGG - Intergenic
1066722752 10:38356572-38356594 AGCCAGGGGCGGGCGCTTCCGGG - Intergenic
1067064070 10:43093879-43093901 GGCCAGGCGCAGGCTCCTGCTGG + Intronic
1067416430 10:46106495-46106517 GGCCGGGCGCCGGCGCCTGCGGG - Intergenic
1067436561 10:46282973-46282995 GGCCGGGCGCCGGCGCCTGCGGG - Intergenic
1072539929 10:96390539-96390561 GGCCAGGATCAGGCGCCAGCTGG + Intronic
1073143092 10:101261792-101261814 AGCCAGCAGCCAGCACCTGCAGG + Intergenic
1074772234 10:116741963-116741985 AGGCAGGAGTGGGAGCCTGGGGG - Intronic
1075778993 10:125004990-125005012 AGCCACGGGGGGGCTCCTGCTGG + Intronic
1076121464 10:127940084-127940106 AGCCAGGTGCGGGCAGGTGCAGG + Intronic
1076707006 10:132307710-132307732 GGCCAGCAGCGGGCGGCGGCAGG + Exonic
1077368363 11:2170399-2170421 AGCCAGGAGCGGGCGCCTGCGGG - Intronic
1077438294 11:2555508-2555530 AGCCAGGCGTGGGCGTCTCCGGG + Intronic
1079035230 11:17014526-17014548 ATCCAGGCGCGGGCTCCTGAGGG + Intergenic
1080902578 11:36510017-36510039 CGCCAGGAGGAGGCGCCTGAAGG + Intronic
1083304569 11:61755733-61755755 AGCCTGGAAGGGGTGCCTGCTGG + Intronic
1085518100 11:77122935-77122957 AGCCAGGAGATGGACCCTGCTGG - Intronic
1087789352 11:102390953-102390975 AGCCAGTAGCTGGCACTTGCAGG + Intergenic
1088797176 11:113273921-113273943 CCCCAGGAGCAGCCGCCTGCTGG + Intronic
1089576063 11:119444884-119444906 AGCCAGGAGTGGGAGCATGGAGG - Intergenic
1090729627 11:129558358-129558380 AGCCATGAGCGGGGCCCTGGTGG - Intergenic
1090758607 11:129816114-129816136 AGCCCGGAGGGGGCCCCAGCTGG - Intronic
1091113637 11:132994224-132994246 TGCCAGGAGCCGGCGCGCGCGGG + Intronic
1091846835 12:3662745-3662767 AGCCAGGAGCCTGTGTCTGCAGG + Intronic
1095955202 12:47802082-47802104 AGCCAGGAGGTGGCGGCTCCAGG - Intronic
1096549067 12:52360411-52360433 AGCCAGGAGGAGGGGGCTGCTGG + Exonic
1096647678 12:53047433-53047455 TGCCAGGGGCGGGCGCCAGGGGG + Intronic
1097243458 12:57591763-57591785 GGCCAGGACCGGGCGCAAGCGGG + Intronic
1098288627 12:68933629-68933651 AGCCCCGCGCGGGCTCCTGCGGG + Intronic
1101908626 12:108846422-108846444 AGCCAGGAGCTGCTGCCAGCAGG + Intronic
1103508458 12:121456946-121456968 AGCCAGGCGGGGGCCACTGCCGG - Intronic
1103565270 12:121812137-121812159 CGCCAGCAGGGGGCGCCCGCGGG - Intronic
1104035054 12:125092164-125092186 AGCCAGGAGAGGGCCCTGGCTGG - Intronic
1108149734 13:47521116-47521138 AGCCAGCAGCGGCAGCCTGCTGG - Intergenic
1110436312 13:75481543-75481565 AGCCCGAGGCGGGCGGCTGCGGG - Exonic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113735050 13:112672524-112672546 AGGCAGGCACGGGTGCCTGCTGG + Intronic
1118293754 14:64549934-64549956 AGCCGTGTGCAGGCGCCTGCGGG + Exonic
1119082196 14:71705689-71705711 AGCCATGAGAGGGCTCCAGCAGG + Intronic
1119705172 14:76778859-76778881 AGCCAGCAGCGGCTGCCTGGTGG - Intronic
1119731387 14:76953506-76953528 AGCCAGGAGCTGTCCCCTGTGGG - Intergenic
1120979818 14:90279839-90279861 AGCCAGGAGTGGGCACAGGCAGG + Intronic
1122128374 14:99591327-99591349 AGCCTTGAGCGGGCGCATGTGGG - Intronic
1122436657 14:101705828-101705850 GGCGGGGAGCGGCCGCCTGCGGG - Intergenic
1123112315 14:105878775-105878797 AGCCCGGAGCGGGCGCTGGGGGG - Intergenic
1124869158 15:33523249-33523271 AGCCAGCAGCGGCAACCTGCTGG + Intronic
1127931847 15:63601996-63602018 ACCCAGGACCAGGCGGCTGCCGG - Exonic
1132157313 15:99504698-99504720 GGCCAGGACCGGGCTCCTCCAGG + Intergenic
1132498205 16:273711-273733 AGCCTGGGTTGGGCGCCTGCAGG + Intronic
1132621139 16:868801-868823 AGGCAGGAGGTGGGGCCTGCTGG - Intronic
1132785501 16:1655075-1655097 ACCCGGGAGCGGGCGTCTGCAGG - Intronic
1132883353 16:2171916-2171938 AGGCAGGAGCGGGCGCCGTGCGG - Intronic
1132941316 16:2509825-2509847 CTCCAGGAGCAGGTGCCTGCAGG + Intronic
1134797685 16:17056847-17056869 AGCCTGGAGCCTGGGCCTGCAGG + Intergenic
1136169916 16:28482657-28482679 AGGCTGGAGCTGGAGCCTGCAGG + Exonic
1136222325 16:28836357-28836379 AGCCAGGAGCAAGCCCCTGGCGG - Exonic
1137251884 16:46747188-46747210 AGGCAGGAGCCGGAGCCTGGGGG - Intronic
1137842046 16:51649790-51649812 AGGCAGGCGAGGGCGTCTGCAGG - Intergenic
1138314265 16:56055032-56055054 AGAGAAAAGCGGGCGCCTGCTGG + Intergenic
1138598805 16:58043203-58043225 AGCCAGTAGCGGTCACCTACAGG - Exonic
1139557057 16:67719091-67719113 GGCCGGGAGCGGGCGCCGACAGG - Intronic
1139976993 16:70820265-70820287 AACCAGGAGGGGGAGCTTGCCGG - Intronic
1141085931 16:81095879-81095901 AGCCGGGAGGGGAGGCCTGCGGG - Intronic
1141241314 16:82267581-82267603 AGGCTGGAGCTGGCCCCTGCAGG - Intergenic
1141842311 16:86580980-86581002 AGGGAAGAGCGGGCGGCTGCAGG - Exonic
1142304444 16:89277757-89277779 ATCCAGGAGCGGGCGCCCTCGGG - Intronic
1143361510 17:6375204-6375226 AGCCGGGAGCTGGGACCTGCCGG - Intergenic
1143504449 17:7356072-7356094 AGCAAGGACCTGGGGCCTGCAGG + Intronic
1149328360 17:55556001-55556023 AGCCAGGAGCAGCCACCCGCAGG - Intergenic
1149610311 17:57954746-57954768 CGGCAGGCGGGGGCGCCTGCTGG - Intronic
1149648102 17:58255004-58255026 AGCCAGGAGTGGGAGCCAGGTGG - Intronic
1149648186 17:58255610-58255632 AGCCAGGAGTGGGAGCCAGGCGG + Intronic
1150150973 17:62808428-62808450 AGCCAGTCGTGGGCGCCCGCCGG + Intergenic
1150764607 17:67993467-67993489 AGCCCTGCGCGCGCGCCTGCCGG - Exonic
1151384876 17:73748872-73748894 AGGCAGGAGCGGGAGCCTGAGGG + Intergenic
1151816456 17:76473744-76473766 TGCCAGGAGGGGGCACCGGCAGG + Intronic
1152375014 17:79914501-79914523 AGCCAGCAGCGGGCACTGGCCGG - Intergenic
1152631627 17:81413218-81413240 AGCCAGCAGCGAGCGCCCGGGGG - Intronic
1155785814 18:29898363-29898385 AGCTAGCAGCGGCCACCTGCTGG - Intergenic
1156533839 18:37844338-37844360 GGCCTGGGGCAGGCGCCTGCTGG - Intergenic
1161111799 19:2474987-2475009 CGCCAGGCACGGCCGCCTGCAGG - Intergenic
1161469202 19:4447946-4447968 TGCCAGCAGGGGGCTCCTGCGGG + Intronic
1161702719 19:5804224-5804246 TGCCAGGAGGGGGCGCCGGCGGG + Intergenic
1161707533 19:5829175-5829197 AGCCCGAAGCCGGCGCCTGCTGG + Intergenic
1162998761 19:14352764-14352786 AGCCAGGAGCAGGGGCCAGAGGG + Intergenic
1163318118 19:16555356-16555378 AGCCAGGAGCAGGAGCGTCCAGG + Exonic
1164977149 19:32581577-32581599 AGCCTGGAGCGGGCTCGTCCTGG + Intronic
1165175875 19:33929394-33929416 AGTCAGGAGCGGGTGACTGGAGG + Intergenic
1166643380 19:44513108-44513130 GGCCAGCAGGGGGCGCTTGCCGG - Intronic
1167578945 19:50330921-50330943 AGGGAGGAGGCGGCGCCTGCGGG + Intronic
1167688215 19:50969402-50969424 AGCCCGGAGTGAGGGCCTGCAGG - Intronic
1168013512 19:53553893-53553915 AGCCGGGAACGGGCGTCTGCAGG + Intronic
1168242990 19:55096509-55096531 TGGCAGCTGCGGGCGCCTGCTGG - Intronic
1168264761 19:55216723-55216745 AGCCAGGGCCGGGAGCCTCCTGG + Intergenic
925911658 2:8577737-8577759 AGCCAGGATTGGAAGCCTGCGGG - Intergenic
926113177 2:10195449-10195471 AGCCAGCAGCAGGAGCATGCGGG + Intronic
927442592 2:23129718-23129740 AGCCAGGAGGCGGAGCTTGCAGG + Intergenic
927872716 2:26633786-26633808 AGGCAGGAGGGGCTGCCTGCGGG + Intronic
931461974 2:62457324-62457346 AGCCAGGAGTGGACGGTTGCGGG + Intergenic
931479916 2:62630379-62630401 CTCCAGGAGGGGGCGGCTGCCGG - Intergenic
931665895 2:64609395-64609417 AGCGCGGCGCGGCCGCCTGCAGG - Intergenic
932438851 2:71719116-71719138 AGCCAGGACCTGGGGCCAGCTGG - Intergenic
934746172 2:96761043-96761065 CGCCAGGAGGAGGCGCCCGCGGG - Exonic
936946425 2:117935138-117935160 AGTCAAGAGCGGAAGCCTGCTGG + Intronic
941967608 2:171314965-171314987 AGTCAGGAGCAGTCACCTGCAGG - Intergenic
944666458 2:201963169-201963191 GGCCAGGAGTGGGAGCCAGCGGG + Intergenic
946372502 2:219289545-219289567 AGCCCGGAGCCGGTCCCTGCTGG - Intergenic
948216949 2:236239186-236239208 AACCAAGAGCTGGCACCTGCAGG - Intronic
948309008 2:236971260-236971282 AGCCAGGAGCTGCAGCCTGCCGG - Intergenic
948425937 2:237886563-237886585 GGGCTGGAGCGGGCGACTGCTGG + Intronic
948467385 2:238158882-238158904 AGCCGGGAGGGGGCGCGGGCGGG + Intergenic
949026243 2:241767746-241767768 AGCCAGGAGCGAGGGGCTGAAGG - Exonic
1168796033 20:610515-610537 AGCCGGGAACGGGGGCCTTCGGG - Intergenic
1169190844 20:3658449-3658471 AGCCAGGTGGGGGTCCCTGCTGG + Intergenic
1169216308 20:3796543-3796565 AGCCTGGCGCGGGCTCCGGCTGG - Exonic
1170999301 20:21396927-21396949 GGCCAGGAGCGCGGGGCTGCGGG - Intronic
1171307464 20:24118610-24118632 AGCCATGGGCGGGCTGCTGCCGG + Intergenic
1172697203 20:36831109-36831131 AGCCAGGAAAGGAGGCCTGCAGG + Intronic
1172902267 20:38343956-38343978 AGCCAGCAGTGGGCACCTGCAGG + Intergenic
1174248043 20:49196686-49196708 ACCCAGGAGCCGGAGGCTGCAGG + Intergenic
1174804354 20:53593441-53593463 CGCCGGGAGCGGGGGTCTGCGGG - Intronic
1175215993 20:57391938-57391960 CGGCAGGTGCGGGCGCCGGCTGG - Intronic
1175767836 20:61603470-61603492 AGCCAGGAGAGGGTTCCTGCTGG + Intronic
1175808074 20:61841789-61841811 CGCCAGGAGAGGAGGCCTGCAGG - Intronic
1178078190 21:29032374-29032396 AGCCAGGAGTGGTGGCATGCAGG - Intronic
1178445720 21:32639718-32639740 AGCCACGCGCGGGCATCTGCTGG - Exonic
1178498881 21:33109778-33109800 AGCCGGGAGCGAGGACCTGCGGG - Intergenic
1178918450 21:36722750-36722772 CCCCAGGAGCGGGCGACGGCAGG + Intronic
1179890689 21:44333785-44333807 GGCCTGGAGCGGGGACCTGCAGG + Intronic
1180698481 22:17769253-17769275 ACCCAGGAGCGGCTGGCTGCTGG + Intronic
1182293560 22:29299969-29299991 AGCCAGGAAGGGGCACCTGGGGG + Intronic
1182293583 22:29300039-29300061 AGCCAGGAAGGGGCACCTGGGGG + Intronic
1182511436 22:30822871-30822893 AGCCGGGAGCGCACGCCGGCGGG - Intronic
1183315776 22:37136172-37136194 AGGCAGGAGGGGGCGGCTGGAGG - Intronic
1183663563 22:39234980-39235002 AGGCAGGAGGGGGCCCCAGCTGG - Intronic
1184412109 22:44331529-44331551 AGCCGGGAGCCGGCGCCCGCGGG + Intergenic
1185023342 22:48393345-48393367 AGCCAGGATCTGGAGCCTGGAGG + Intergenic
1185181880 22:49368421-49368443 TGCCAGAAGCTGGTGCCTGCAGG - Intergenic
1185249892 22:49795686-49795708 AGCCAGCAGCGGGCACCAGGTGG + Intronic
951640384 3:24829408-24829430 AGCCAGGAGAGCGCGCTGGCGGG + Intergenic
951981777 3:28575179-28575201 TGCCCGGGGCGGGCGCCAGCTGG - Intergenic
954326516 3:49867065-49867087 AGAGAGGAGGGGGTGCCTGCAGG - Intronic
956420924 3:69085525-69085547 TGCCAGGATCGGGCTCTTGCTGG + Intronic
958129528 3:89400278-89400300 AGCCAGGAGGCGGAGCTTGCAGG - Intronic
958527379 3:95280598-95280620 AGCAAGGAGAGGGGTCCTGCAGG - Intergenic
966862588 3:184238820-184238842 GGACAGGAGCGGGAGCCTGCAGG - Exonic
966885760 3:184377399-184377421 GCCCAGGAACGGGCACCTGCTGG + Intronic
968702557 4:2063753-2063775 ACCCAGAAGCAGGAGCCTGCAGG - Exonic
968804323 4:2762733-2762755 AGCCAGGAGCGGCAACCCGCTGG - Intergenic
969079826 4:4609734-4609756 AGCCAGGAAGGGGCCCTTGCCGG + Intergenic
969263286 4:6046947-6046969 AGCAAGGAGCAGGAACCTGCTGG - Intronic
969273022 4:6115830-6115852 AGGCAGGATGGGGCGGCTGCAGG + Intronic
971379787 4:26086116-26086138 GGCCAGGAGCAGTCTCCTGCAGG - Intergenic
980373675 4:131913536-131913558 AGCCAGCAGCGGCAACCTGCTGG - Intergenic
982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG + Intergenic
984639289 4:182144602-182144624 AGCGGGGAGCGGGCGCCGGCGGG - Intronic
985588174 5:751465-751487 AGGCAGGGGCGGGGGCATGCAGG + Intronic
985602844 5:843928-843950 AGGCAGGGGCGGGGGCATGCAGG + Intronic
986372831 5:7097933-7097955 AGCCAGCTGGGGGGGCCTGCTGG - Intergenic
988039923 5:25875991-25876013 AGCCAGCAGCGGCAACCTGCTGG - Intergenic
990510945 5:56488496-56488518 AGCCAGCAGCGGCAACCTGCTGG + Intergenic
997383198 5:133452022-133452044 AGCCAGGTGTGGGCTCCTGGGGG - Intronic
997505273 5:134411980-134412002 CGCCCGGAGCGGCGGCCTGCGGG + Intergenic
998215916 5:140238666-140238688 AGCCATGAGACGGCTCCTGCAGG - Intronic
999143919 5:149380454-149380476 AGCCAGGAGGGTGGGCCTGAGGG - Intronic
999646234 5:153719523-153719545 AGCCAGGAGAGGGCACGTGTAGG - Intronic
1001051510 5:168418173-168418195 ATCCAGGAGAGGCCGACTGCAGG + Intronic
1002001521 5:176199034-176199056 TGACAGGAGCAGGCGCCCGCGGG - Intergenic
1003128110 6:3372366-3372388 AGCCAGCAGGAGGAGCCTGCAGG - Intronic
1004483120 6:16039926-16039948 AGCCAGCAGCGGTAACCTGCTGG - Intergenic
1006375172 6:33667984-33668006 AGGGAGGAGCAGGCGCCGGCCGG - Intronic
1017822441 6:158059416-158059438 AGCCTGGAGGTGGCTCCTGCAGG + Intronic
1018889570 6:167973746-167973768 AGCCCGGAGCAGGCTCCTGCAGG + Intergenic
1019408565 7:896865-896887 GGCCACGAGGGGCCGCCTGCGGG - Intergenic
1019559189 7:1647579-1647601 AGCCTGGAGCGAGGCCCTGCGGG + Intergenic
1019563574 7:1669341-1669363 AGCGGGGAGGGGGCGCCGGCGGG + Intergenic
1019684691 7:2374667-2374689 AGCCGGGTGCAGGCGCCTGAGGG - Intronic
1024272736 7:47655006-47655028 AGCCAGGGCTGGGCGCCTGTGGG - Intergenic
1024975439 7:55109913-55109935 AGCGCGGAGAGGTCGCCTGCCGG - Intronic
1025106594 7:56175639-56175661 AGCCCTGAGCGGGGCCCTGCTGG + Intergenic
1030300190 7:107966787-107966809 AGGCAGCACCGGGAGCCTGCTGG - Intronic
1030334277 7:108307747-108307769 GGCCAGGACCAGGCCCCTGCTGG - Intronic
1032197539 7:129798296-129798318 AGCCAGGGCCCAGCGCCTGCTGG - Intergenic
1032794860 7:135269183-135269205 AGCCAGGAGAGAGCTCCTGGTGG + Intergenic
1034435394 7:151060642-151060664 AGGTGGGAGTGGGCGCCTGCAGG + Intronic
1035396722 7:158539811-158539833 AGCCTGGAGCTGGTGGCTGCTGG + Intronic
1036256296 8:7209351-7209373 AGACAGGAGCAGGCACGTGCTGG + Intergenic
1036308347 8:7667935-7667957 AGACAGGAGCAGGCACGTGCTGG + Intergenic
1036361188 8:8078143-8078165 AGACAGGAGCAGGCACGTGCTGG - Intergenic
1036694849 8:10967782-10967804 CGCCAGGAGCAGGAGCCTCCTGG - Intronic
1038100094 8:24363772-24363794 TGCCAGGAACTGGCTCCTGCAGG - Intergenic
1038315386 8:26480278-26480300 AGCCAGGAGGAGGAGCTTGCAGG + Intronic
1038430012 8:27492632-27492654 AGCCAGTAGCGGCAACCTGCTGG - Intronic
1039589599 8:38735463-38735485 AGCCAGAGGAGGGCACCTGCAGG + Intronic
1042560818 8:70071175-70071197 ACCGCGGAGCGGGCGCCTCCTGG + Exonic
1044675012 8:94719896-94719918 GGCCAGGAGCGGGCCCCCGGAGG + Exonic
1046765986 8:118070727-118070749 AGACAGGAGCGGGAACCTTCTGG + Intronic
1047415892 8:124664122-124664144 AGGCAGAAGCCAGCGCCTGCAGG + Intronic
1053819640 9:41953301-41953323 AGCCGAGAGCGGGTGCCCGCTGG + Exonic
1056752152 9:89359837-89359859 AGCCAGGATCTGGCTCCGGCAGG - Intergenic
1057192458 9:93095537-93095559 GGGCAGGAGCGGGCGCCTCCAGG + Intergenic
1057881611 9:98796560-98796582 GGCCGGAAGGGGGCGCCTGCGGG - Intronic
1059123350 9:111661781-111661803 GGCCCGGACCGGGCGCCAGCGGG + Intronic
1059414715 9:114155755-114155777 GGCCTGGCGCGGGCGCCCGCGGG + Exonic
1059769906 9:117415076-117415098 AGCCCGGAGCTGGGGGCTGCTGG - Intergenic
1061853654 9:133429773-133429795 AGCCAAGAGCCGGCTCCTGGTGG + Intronic
1062011137 9:134267489-134267511 AGCCAGAAGAGGGAGCCAGCAGG + Intergenic
1062235501 9:135505926-135505948 AGCTACGAGTGGGCGCTTGCTGG + Intergenic
1062323300 9:136001043-136001065 AGACAGGTGCAGGCCCCTGCTGG + Intergenic
1062697740 9:137884116-137884138 AGCCTGGGGCTGGCCCCTGCTGG + Intronic
1062726546 9:138077274-138077296 AGCCAGCACCGGGGGCTTGCAGG - Intronic
1194601311 X:95924489-95924511 AGCCAGGAGGTGGCACTTGCAGG - Intergenic
1199679957 X:150217514-150217536 TGCCAAGGGCGGGAGCCTGCTGG + Intergenic
1199783318 X:151082693-151082715 AGCCAGGAGAGGGGAGCTGCGGG - Intergenic