ID: 1077368701

View in Genome Browser
Species Human (GRCh38)
Location 11:2171723-2171745
Sequence CCGCAGGGCCGTGTCTGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077368701_1077368714 10 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368714 11:2171756-2171778 CCTGTGGCGTGGTGGCGTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 98
1077368701_1077368717 15 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368717 11:2171761-2171783 GGCGTGGTGGCGTCGGGGGTGGG 0: 1
1: 1
2: 3
3: 27
4: 393
1077368701_1077368719 30 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368719 11:2171776-2171798 GGGGTGGGCATGGCTCAGTGTGG 0: 1
1: 0
2: 3
3: 47
4: 443
1077368701_1077368711 8 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368711 11:2171754-2171776 GGCCTGTGGCGTGGTGGCGTCGG 0: 1
1: 0
2: 0
3: 30
4: 277
1077368701_1077368715 11 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368715 11:2171757-2171779 CTGTGGCGTGGTGGCGTCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 142
1077368701_1077368718 20 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368718 11:2171766-2171788 GGTGGCGTCGGGGGTGGGCATGG 0: 1
1: 1
2: 2
3: 64
4: 739
1077368701_1077368707 -1 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368707 11:2171745-2171767 GAAGCCCTTGGCCTGTGGCGTGG 0: 1
1: 0
2: 0
3: 15
4: 178
1077368701_1077368712 9 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368712 11:2171755-2171777 GCCTGTGGCGTGGTGGCGTCGGG 0: 1
1: 1
2: 0
3: 15
4: 159
1077368701_1077368706 -6 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368706 11:2171740-2171762 CTGCGGAAGCCCTTGGCCTGTGG 0: 1
1: 1
2: 0
3: 19
4: 238
1077368701_1077368708 2 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368708 11:2171748-2171770 GCCCTTGGCCTGTGGCGTGGTGG 0: 1
1: 0
2: 2
3: 17
4: 231
1077368701_1077368716 14 Left 1077368701 11:2171723-2171745 CCAGCTCAGACACGGCCCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1077368716 11:2171760-2171782 TGGCGTGGTGGCGTCGGGGGTGG 0: 1
1: 0
2: 1
3: 31
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077368701 Original CRISPR CCGCAGGGCCGTGTCTGAGC TGG (reversed) Exonic