ID: 1077369185

View in Genome Browser
Species Human (GRCh38)
Location 11:2173642-2173664
Sequence GTGCAGACCCTGTCCTCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077369181_1077369185 -1 Left 1077369181 11:2173620-2173642 CCCTGCTGTCTCTCAGCACCCAG No data
Right 1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG No data
1077369179_1077369185 8 Left 1077369179 11:2173611-2173633 CCGCTCGGCCCCTGCTGTCTCTC No data
Right 1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG No data
1077369178_1077369185 12 Left 1077369178 11:2173607-2173629 CCTACCGCTCGGCCCCTGCTGTC No data
Right 1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG No data
1077369180_1077369185 0 Left 1077369180 11:2173619-2173641 CCCCTGCTGTCTCTCAGCACCCA No data
Right 1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG No data
1077369175_1077369185 29 Left 1077369175 11:2173590-2173612 CCCTGGGGGCAGGGAAGCCTACC No data
Right 1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG No data
1077369182_1077369185 -2 Left 1077369182 11:2173621-2173643 CCTGCTGTCTCTCAGCACCCAGT No data
Right 1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG No data
1077369176_1077369185 28 Left 1077369176 11:2173591-2173613 CCTGGGGGCAGGGAAGCCTACCG No data
Right 1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077369185 Original CRISPR GTGCAGACCCTGTCCTCTCT CGG Intergenic
No off target data available for this crispr