ID: 1077370157

View in Genome Browser
Species Human (GRCh38)
Location 11:2177993-2178015
Sequence GGCTCAGGCTTAGGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077370157_1077370164 -5 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data
1077370157_1077370162 -10 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370162 11:2178006-2178028 AGCCTGAGCCAGCCTGAGTCTGG No data
1077370157_1077370172 25 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370172 11:2178041-2178063 GGAGCCAGGTGAGCAGTGAGGGG No data
1077370157_1077370171 24 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370157_1077370170 23 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370170 11:2178039-2178061 CTGGAGCCAGGTGAGCAGTGAGG No data
1077370157_1077370167 4 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data
1077370157_1077370168 11 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370168 11:2178027-2178049 GGCATGGAGCTCCTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077370157 Original CRISPR GGCTCAGGCTTAGGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr