ID: 1077370162

View in Genome Browser
Species Human (GRCh38)
Location 11:2178006-2178028
Sequence AGCCTGAGCCAGCCTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077370156_1077370162 -9 Left 1077370156 11:2177992-2178014 CCCCTCCAGCCCTAAGCCTGAGC No data
Right 1077370162 11:2178006-2178028 AGCCTGAGCCAGCCTGAGTCTGG No data
1077370151_1077370162 22 Left 1077370151 11:2177961-2177983 CCAGCCAGGTATGGGTGGAACCG No data
Right 1077370162 11:2178006-2178028 AGCCTGAGCCAGCCTGAGTCTGG No data
1077370153_1077370162 2 Left 1077370153 11:2177981-2178003 CCGTCCTACTCCCCCTCCAGCCC No data
Right 1077370162 11:2178006-2178028 AGCCTGAGCCAGCCTGAGTCTGG No data
1077370157_1077370162 -10 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370162 11:2178006-2178028 AGCCTGAGCCAGCCTGAGTCTGG No data
1077370155_1077370162 -8 Left 1077370155 11:2177991-2178013 CCCCCTCCAGCCCTAAGCCTGAG No data
Right 1077370162 11:2178006-2178028 AGCCTGAGCCAGCCTGAGTCTGG No data
1077370154_1077370162 -2 Left 1077370154 11:2177985-2178007 CCTACTCCCCCTCCAGCCCTAAG No data
Right 1077370162 11:2178006-2178028 AGCCTGAGCCAGCCTGAGTCTGG No data
1077370152_1077370162 18 Left 1077370152 11:2177965-2177987 CCAGGTATGGGTGGAACCGTCCT No data
Right 1077370162 11:2178006-2178028 AGCCTGAGCCAGCCTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077370162 Original CRISPR AGCCTGAGCCAGCCTGAGTC TGG Intergenic
No off target data available for this crispr