ID: 1077370164

View in Genome Browser
Species Human (GRCh38)
Location 11:2178011-2178033
Sequence GAGCCAGCCTGAGTCTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077370153_1077370164 7 Left 1077370153 11:2177981-2178003 CCGTCCTACTCCCCCTCCAGCCC No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data
1077370151_1077370164 27 Left 1077370151 11:2177961-2177983 CCAGCCAGGTATGGGTGGAACCG No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data
1077370152_1077370164 23 Left 1077370152 11:2177965-2177987 CCAGGTATGGGTGGAACCGTCCT No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data
1077370159_1077370164 -9 Left 1077370159 11:2177997-2178019 CCAGCCCTAAGCCTGAGCCAGCC No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data
1077370158_1077370164 -6 Left 1077370158 11:2177994-2178016 CCTCCAGCCCTAAGCCTGAGCCA No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data
1077370154_1077370164 3 Left 1077370154 11:2177985-2178007 CCTACTCCCCCTCCAGCCCTAAG No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data
1077370157_1077370164 -5 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data
1077370155_1077370164 -3 Left 1077370155 11:2177991-2178013 CCCCCTCCAGCCCTAAGCCTGAG No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data
1077370156_1077370164 -4 Left 1077370156 11:2177992-2178014 CCCCTCCAGCCCTAAGCCTGAGC No data
Right 1077370164 11:2178011-2178033 GAGCCAGCCTGAGTCTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077370164 Original CRISPR GAGCCAGCCTGAGTCTGGCA TGG Intergenic
No off target data available for this crispr