ID: 1077370167

View in Genome Browser
Species Human (GRCh38)
Location 11:2178020-2178042
Sequence TGAGTCTGGCATGGAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077370156_1077370167 5 Left 1077370156 11:2177992-2178014 CCCCTCCAGCCCTAAGCCTGAGC No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data
1077370158_1077370167 3 Left 1077370158 11:2177994-2178016 CCTCCAGCCCTAAGCCTGAGCCA No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data
1077370154_1077370167 12 Left 1077370154 11:2177985-2178007 CCTACTCCCCCTCCAGCCCTAAG No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data
1077370160_1077370167 -4 Left 1077370160 11:2178001-2178023 CCCTAAGCCTGAGCCAGCCTGAG No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data
1077370157_1077370167 4 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data
1077370161_1077370167 -5 Left 1077370161 11:2178002-2178024 CCTAAGCCTGAGCCAGCCTGAGT No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data
1077370155_1077370167 6 Left 1077370155 11:2177991-2178013 CCCCCTCCAGCCCTAAGCCTGAG No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data
1077370159_1077370167 0 Left 1077370159 11:2177997-2178019 CCAGCCCTAAGCCTGAGCCAGCC No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data
1077370153_1077370167 16 Left 1077370153 11:2177981-2178003 CCGTCCTACTCCCCCTCCAGCCC No data
Right 1077370167 11:2178020-2178042 TGAGTCTGGCATGGAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077370167 Original CRISPR TGAGTCTGGCATGGAGCTCC TGG Intergenic
No off target data available for this crispr