ID: 1077370171

View in Genome Browser
Species Human (GRCh38)
Location 11:2178040-2178062
Sequence TGGAGCCAGGTGAGCAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077370157_1077370171 24 Left 1077370157 11:2177993-2178015 CCCTCCAGCCCTAAGCCTGAGCC No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370165_1077370171 3 Left 1077370165 11:2178014-2178036 CCAGCCTGAGTCTGGCATGGAGC No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370156_1077370171 25 Left 1077370156 11:2177992-2178014 CCCCTCCAGCCCTAAGCCTGAGC No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370161_1077370171 15 Left 1077370161 11:2178002-2178024 CCTAAGCCTGAGCCAGCCTGAGT No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370155_1077370171 26 Left 1077370155 11:2177991-2178013 CCCCCTCCAGCCCTAAGCCTGAG No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370160_1077370171 16 Left 1077370160 11:2178001-2178023 CCCTAAGCCTGAGCCAGCCTGAG No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370159_1077370171 20 Left 1077370159 11:2177997-2178019 CCAGCCCTAAGCCTGAGCCAGCC No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370158_1077370171 23 Left 1077370158 11:2177994-2178016 CCTCCAGCCCTAAGCCTGAGCCA No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370163_1077370171 9 Left 1077370163 11:2178008-2178030 CCTGAGCCAGCCTGAGTCTGGCA No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data
1077370166_1077370171 -1 Left 1077370166 11:2178018-2178040 CCTGAGTCTGGCATGGAGCTCCT No data
Right 1077370171 11:2178040-2178062 TGGAGCCAGGTGAGCAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077370171 Original CRISPR TGGAGCCAGGTGAGCAGTGA GGG Intergenic
No off target data available for this crispr