ID: 1077372269

View in Genome Browser
Species Human (GRCh38)
Location 11:2188667-2188689
Sequence GTGTTTTAGGGGTTCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077372269_1077372280 22 Left 1077372269 11:2188667-2188689 CCCACAGAGAACCCCTAAAACAC No data
Right 1077372280 11:2188712-2188734 AAGTGGGCGAAGGACGTAGACGG No data
1077372269_1077372279 12 Left 1077372269 11:2188667-2188689 CCCACAGAGAACCCCTAAAACAC No data
Right 1077372279 11:2188702-2188724 CCAGATTCAAAAGTGGGCGAAGG No data
1077372269_1077372281 23 Left 1077372269 11:2188667-2188689 CCCACAGAGAACCCCTAAAACAC No data
Right 1077372281 11:2188713-2188735 AGTGGGCGAAGGACGTAGACGGG No data
1077372269_1077372277 6 Left 1077372269 11:2188667-2188689 CCCACAGAGAACCCCTAAAACAC No data
Right 1077372277 11:2188696-2188718 CAAACACCAGATTCAAAAGTGGG No data
1077372269_1077372276 5 Left 1077372269 11:2188667-2188689 CCCACAGAGAACCCCTAAAACAC No data
Right 1077372276 11:2188695-2188717 CCAAACACCAGATTCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077372269 Original CRISPR GTGTTTTAGGGGTTCTCTGT GGG (reversed) Intergenic
No off target data available for this crispr