ID: 1077372751

View in Genome Browser
Species Human (GRCh38)
Location 11:2191176-2191198
Sequence TCCCGCCAGGCAGGTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077372751_1077372761 -2 Left 1077372751 11:2191176-2191198 CCCAGGGCACCTGCCTGGCGGGA No data
Right 1077372761 11:2191197-2191219 GAAGGTCGGGGTGGAGGAAGCGG No data
1077372751_1077372765 24 Left 1077372751 11:2191176-2191198 CCCAGGGCACCTGCCTGGCGGGA No data
Right 1077372765 11:2191223-2191245 CAGGTGGCTGAGATTGCAGAGGG No data
1077372751_1077372762 5 Left 1077372751 11:2191176-2191198 CCCAGGGCACCTGCCTGGCGGGA No data
Right 1077372762 11:2191204-2191226 GGGGTGGAGGAAGCGGATGCAGG No data
1077372751_1077372764 23 Left 1077372751 11:2191176-2191198 CCCAGGGCACCTGCCTGGCGGGA No data
Right 1077372764 11:2191222-2191244 GCAGGTGGCTGAGATTGCAGAGG No data
1077372751_1077372760 -8 Left 1077372751 11:2191176-2191198 CCCAGGGCACCTGCCTGGCGGGA No data
Right 1077372760 11:2191191-2191213 TGGCGGGAAGGTCGGGGTGGAGG No data
1077372751_1077372763 8 Left 1077372751 11:2191176-2191198 CCCAGGGCACCTGCCTGGCGGGA No data
Right 1077372763 11:2191207-2191229 GTGGAGGAAGCGGATGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077372751 Original CRISPR TCCCGCCAGGCAGGTGCCCT GGG (reversed) Intergenic
No off target data available for this crispr