ID: 1077375160

View in Genome Browser
Species Human (GRCh38)
Location 11:2202287-2202309
Sequence AAGGCTCCTTCACCTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077375146_1077375160 14 Left 1077375146 11:2202250-2202272 CCCCGCCCTGGCCCGTGCCTGCA No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375148_1077375160 12 Left 1077375148 11:2202252-2202274 CCGCCCTGGCCCGTGCCTGCAAG No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375149_1077375160 9 Left 1077375149 11:2202255-2202277 CCCTGGCCCGTGCCTGCAAGAGC No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375142_1077375160 23 Left 1077375142 11:2202241-2202263 CCCCGCCTGCCCCGCCCTGGCCC No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375151_1077375160 3 Left 1077375151 11:2202261-2202283 CCCGTGCCTGCAAGAGCCACCTA No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375144_1077375160 21 Left 1077375144 11:2202243-2202265 CCGCCTGCCCCGCCCTGGCCCGT No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375155_1077375160 -3 Left 1077375155 11:2202267-2202289 CCTGCAAGAGCCACCTAGGGAAG No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375140_1077375160 27 Left 1077375140 11:2202237-2202259 CCTGCCCCGCCTGCCCCGCCCTG No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375145_1077375160 18 Left 1077375145 11:2202246-2202268 CCTGCCCCGCCCTGGCCCGTGCC No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375143_1077375160 22 Left 1077375143 11:2202242-2202264 CCCGCCTGCCCCGCCCTGGCCCG No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375147_1077375160 13 Left 1077375147 11:2202251-2202273 CCCGCCCTGGCCCGTGCCTGCAA No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375152_1077375160 2 Left 1077375152 11:2202262-2202284 CCGTGCCTGCAAGAGCCACCTAG No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data
1077375150_1077375160 8 Left 1077375150 11:2202256-2202278 CCTGGCCCGTGCCTGCAAGAGCC No data
Right 1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077375160 Original CRISPR AAGGCTCCTTCACCTGGCCC TGG Intergenic
No off target data available for this crispr