ID: 1077375605

View in Genome Browser
Species Human (GRCh38)
Location 11:2203961-2203983
Sequence TAGCCTGTGTCTGCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077375595_1077375605 26 Left 1077375595 11:2203912-2203934 CCTGGGGCTGGGCTGGGGGAGCC No data
Right 1077375605 11:2203961-2203983 TAGCCTGTGTCTGCTGGGACTGG No data
1077375602_1077375605 -5 Left 1077375602 11:2203943-2203965 CCAGGGTGAACGCGGTGTTAGCC No data
Right 1077375605 11:2203961-2203983 TAGCCTGTGTCTGCTGGGACTGG No data
1077375600_1077375605 5 Left 1077375600 11:2203933-2203955 CCGGTGGACTCCAGGGTGAACGC No data
Right 1077375605 11:2203961-2203983 TAGCCTGTGTCTGCTGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077375605 Original CRISPR TAGCCTGTGTCTGCTGGGAC TGG Intergenic
No off target data available for this crispr