ID: 1077376845

View in Genome Browser
Species Human (GRCh38)
Location 11:2209268-2209290
Sequence GTGACCACCCTGTCAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077376839_1077376845 9 Left 1077376839 11:2209236-2209258 CCAGCTCAGGACTGGGCACGGAG No data
Right 1077376845 11:2209268-2209290 GTGACCACCCTGTCAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077376845 Original CRISPR GTGACCACCCTGTCAGAGCA GGG Intergenic
No off target data available for this crispr