ID: 1077376962

View in Genome Browser
Species Human (GRCh38)
Location 11:2209622-2209644
Sequence CCCCCTGGGAAGCAGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077376962_1077376971 -7 Left 1077376962 11:2209622-2209644 CCCTGGCCCTGCTTCCCAGGGGG No data
Right 1077376971 11:2209638-2209660 CAGGGGGTGGGCTCCAGCCTTGG No data
1077376962_1077376974 10 Left 1077376962 11:2209622-2209644 CCCTGGCCCTGCTTCCCAGGGGG No data
Right 1077376974 11:2209655-2209677 CCTTGGCACTTGCACACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077376962 Original CRISPR CCCCCTGGGAAGCAGGGCCA GGG (reversed) Intergenic
No off target data available for this crispr