ID: 1077380469

View in Genome Browser
Species Human (GRCh38)
Location 11:2234248-2234270
Sequence AGGTCCTATAGCCACAGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077380464_1077380469 -8 Left 1077380464 11:2234233-2234255 CCCTAGGGAGAACCTAGGTCCTA No data
Right 1077380469 11:2234248-2234270 AGGTCCTATAGCCACAGGGTCGG No data
1077380457_1077380469 25 Left 1077380457 11:2234200-2234222 CCGCATAAATGACCTAACAGCGG No data
Right 1077380469 11:2234248-2234270 AGGTCCTATAGCCACAGGGTCGG No data
1077380460_1077380469 13 Left 1077380460 11:2234212-2234234 CCTAACAGCGGCTAGGTGTGTCC No data
Right 1077380469 11:2234248-2234270 AGGTCCTATAGCCACAGGGTCGG No data
1077380465_1077380469 -9 Left 1077380465 11:2234234-2234256 CCTAGGGAGAACCTAGGTCCTAT No data
Right 1077380469 11:2234248-2234270 AGGTCCTATAGCCACAGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077380469 Original CRISPR AGGTCCTATAGCCACAGGGT CGG Intergenic
No off target data available for this crispr