ID: 1077386086

View in Genome Browser
Species Human (GRCh38)
Location 11:2270193-2270215
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 67}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077386086_1077386098 19 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386098 11:2270235-2270257 CGCAACAGTTCCGGGGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 34
1077386086_1077386097 18 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386097 11:2270234-2270256 GCGCAACAGTTCCGGGGACGCGG 0: 1
1: 0
2: 1
3: 1
4: 30
1077386086_1077386096 12 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386096 11:2270228-2270250 GCTGCAGCGCAACAGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
1077386086_1077386095 11 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386095 11:2270227-2270249 GGCTGCAGCGCAACAGTTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1077386086_1077386100 29 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
1077386086_1077386089 -10 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386089 11:2270206-2270228 CGGTGGCCGGTCGCCGCCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 64
1077386086_1077386094 10 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386094 11:2270226-2270248 CGGCTGCAGCGCAACAGTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 48
1077386086_1077386101 30 Left 1077386086 11:2270193-2270215 CCTCCGGTCTCTGCGGTGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1077386101 11:2270246-2270268 CGGGGACGCGGGTCTCCGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077386086 Original CRISPR CCGGCCACCGCAGAGACCGG AGG (reversed) Exonic